Team:Hawaii/Construction of Broad-Host-Range Expression Vector

From 2008.igem.org

Revision as of 04:18, 3 August 2008 by MargaretRuzicka (Talk | contribs)
Projects Events Resources
Sponsors Experiments Milestones Protocols
Notebook (t) Meetings (t)

Contents

Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts

This expression vector will pull parts from the RSF1010 derived broad-host-range plamid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the origional DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.

The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.

Design

Methods

  • Design Primers
  • Design overlapping oligonucleotides
  • Selection of additional BioBrick parts
  • Lay-out of the new vector

Results

pRL1383a Genes w/ BioBrick Ends

name primer length g/c Tm Reviewed By Notes
aadA_fp._sb.1 cctTTCTAGatgagggaagcggtgatcg 19 bp, 28 bp 57.9%, 53.6% 59.4 C, 65.7 C NW isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_fp._sb.1)
aadA_rp._sb.1 aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg 20 bp, 48 bp 45%, 50% 55.4 C, 74.5 C NW isolates the aadA gene only from ATG to TAA-TAA (original name: SmSpOmega_rp._sb.1)
OmegaInterposon_fo._sb.1 cctTTCTAGAGggtgattgattgagcaagc 19 bp, 30 bp 47.4%, 46.7% 54.5 C, 65 C NW will produce mixture of 4 different products, 2/4 will be correct
OmegaInterposon_ro._sb.1 aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc 19 bp, 44 bp 47.4%, 54.5% 54.5 C, 75.5 C NW will produce mixture of 4 different products, 2/4 will be correct
pRL1383aOriV_fb._sb.1 cctTTCTAGAGgaacccctgcaataactgtc 20 bp, 31 bp 55%, 48.4% 56.3 C, 65.9 C NW
pRL1383aOriV_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac 20 bp, 45 bp 55%, 57.8% 58 C, 76.2 C NW
pRL1383aRep_fp._sp.1 cctTTCTAGatgaagaacgacaggactttgc 22 bp, 31 bp 45.5%, 45.2% 58.9 C, 64.9 C NW Begins with RepB
pRL1383aRep_rb._sb.1 aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca 19 bp, 44 bp 63.2%, 61.4% 62.2 C, 78.5 C NW Ends with an existing post-RepC terminator (and not the RepC protein stop codon). Checked the sequence 8/2, the terminator is missing the last C.
p1lytic_fb._sb.1 atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac 43 (need to recalculate) (need to recalculate) NW E-N-X for front ligation; for priming out phage induced high-copy-number origin of replication (amplification begins as RBS, amplifies out of ??? plasmid)
p1lytic_rp._sb.1 cTACTAGTATTAttaccctctgaatcctgccg 32 (need to recalculate) (need to recalculate) NW S for front ligation, introduce additional TTA (TAA) stop codon; for priming out phage induced high-copy-number origin of replication (amplification end as protein coding region stop codon, amplifies out of ??? plasmid)


RP4 Origin of Transfer Sequences for Oligonucleotide Extension

name oligonucleotide set Reviewed by Notes
oriT1_ob._na.1 ctagaggaataagggacagtgaagaaggaacacccgctcg NW complement oriT4
oriT2_ob._na.1 cgggtgggcctacttcacctatcctgcccggctgacgccg NW complement of oriT5
oriT3_ob._na.1 ttggatacaccaaggaaagtctacatactagtagcggccgctgca NW complement of oriT6
oriT4_ob._na.1 GCGGCCGCTACTAGTAtgtagactttccttggtg NW
oriT5_ob._na.1 tatccaacggcgtcagccgggcaggataggtgaagtaggcc NW
oriT6_ob._na.1 cacccgcgagcgggtgttccttcttcactgtcccttattcCT NW

Discussion

  • What was learned and how to do future experiments differently.


[http://manoa.hawaii.edu/ Sponsor_UHM.gif][http://manoa.hawaii.edu/ovcrge/ Sponsor_OVCRGE.gif][http://www.ctahr.hawaii.edu Sponsor_CTAHR.gif]