Team:Brown/Parts
From 2008.igem.org
Cell Lysis for Everyone!BIOBRICKS!!1 BBa_K124003 – This part is the DNA received from John Mekalanos’ Lab at Harvard Medical School, pvj4. The sequence, 1273 base pairs in length, codes for three different proteins. These three proteins, commonly known as the S, R, and Rz genes, encode for cell lysis. The three genes packaged together are regularly called the “Cell Lysis Cassette.” The S gene is a holin and the R gene is an endolysin. Little is known about the function of the Rz gene in cell lysis but it is involved in many cell lysis processes. * Biobrick Primers containing proper Prefix and Suffix: * Prefix: 5’ atg aaa tca atg gac aaa atc tca act ggc ATG AAA TCA ATG GAC AAA ATC TCA ACT GGC 3' Melting Point = 58 deg C * Suffix: 5’ GTT TCT TCC TGC AGC GGC CGC TAC TAG TA cta tct gca ctg ctc att aat ata ctt c 3' Melting Point = 56 deg C
* Biobrick Primers containing proper Prefix and Suffix: * Prefix: 5' GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGCCAGAAAAACATGACCTGTTGGC 3' Melting Point = 58 deg C * Suffix: 5' GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTA TTG ATT TCT ACC ATC TTC TAC TCC GGC 3' Melting Point =59 deg C
* Biobrick Primers containing proper Prefix and Suffix: * Prefix: 5' GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGCCAGAAAAACATGACCTGTTGGC 3'Melting Point = 58 * Suffix: 5’ GTT TCT TCC TGC AGC GGC CGC TAC TAG TA cta tct gca ctg ctc att aat ata ctt c 3' Melting Point = 56 |