Team:Hawaii/Construction of Broad-Host-Range Expression Vector
From 2008.igem.org
Projects | Events | Resources | ||
---|---|---|---|---|
Sponsors | Experiments | Milestones | Protocols | |
Notebook (t) | Meetings (t) |
Contents |
Construction of Broad-Host-Range Expression Vector from pRL1383a and Other Parts
This expression vector will pull parts from the RSF1010 derived broad-host-range plasmid pRL1383a, the self-transmissible plasmid RP4 and also from available BioBrick parts. These parts will be obtained through either PCR amplification from the original DNA, by synthetically constructing them as outlined in Silver's method for overlapping oligonucleotides, and finally through extraction from the BioBrick parts registry.
The obtained parts will then be maintained on seperate plasmids then later compiled onto the BioBrick Base Vector, [http://partsregistry.org/Part:BBa_I51020 BBa_I51020]. The mobility of this vector will be tested by first transforming into E. coli then conjugatively transferred to SynechocystisPCC6803, followed by the final test of cloning in genes and testing their expression in both E. coli and SynechocystisPCC6803.
Design
Methods
- Design Primers
- Design overlapping oligonucleotides and oligonucleotide inserts
- Selection of additional BioBrick parts
- Lay-out of the new vector
Results
- These genes were amplified from pRL1383a in all cases except for the P1 lytic region which will be amplified from a BioBrick plasmid: pSB2K3.
pRL1383a Genes w/ BioBrick Ends
name | primer | Tm | Reviewed By | Notes |
---|---|---|---|---|
aadA_fp._sb.1 | cctTTCTAGatgagggaagcggtgatcg | 59.4/65.7 C | NW | isolates aadA from ATG to TAA-TAA |
aadA_rp._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAttattatttgccgactaccttgg | 55.4/74.5 | NW | isolates aadA from ATG to TAA-TAA |
OmegaInterposon_fo._sb.1 | cctTTCTAGAGggtgattgattgagcaagc | 54.5/65 | NW | mixture of 4 products, 2/4 correct |
OmegaInterposon_ro._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAggtgattgattgagcaagc | 54.5/75.5 | NW | mixture of 4 products, 2/4 correct |
pRL1383aOriV_fb._sb.1 | cctTTCTAGAGgaacccctgcaataactgtc | 56.3/65.9 | NW | |
pRL1383aOriV_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAgctgaatgatcgaccgagac | 58/76.2 | NW | |
pRL1383aRep_fp._sp.1 | cctTTCTAGatgaagaacgacaggactttgc | 58.9/64.9 | NW | Begins with RepB |
pRL1383aRep_rb._sb.1 | aaggCTGCAGCGGCCGCTACTAGTAcctatggagctgtgcggca | 62.2/78.5 | NW | Ends RepC terminator.8/2:the terminator is missing the last C. |
p1lytic_fb._sb.1 | atGAATTCGCGGCCGCTTCTAGAGcgcagttgcaaaccctcac | 59.5/76.2 | NW | E-N-X(front ligation);inducible high-copy-#, incl. Plac;from pSB2K3 |
p1lytic_rp._sb.1 | cTACTAGTATTAttaccctctgaatcctgccg | 59.2/63.5 | NW | S(front ligation), ends w/(TAATAA);induced high-copy-#;from pSB2K3 |
- The origin of conjugative transfer will be synthetically constructed using the Overlapping Oligonucleotides method from the Silver Lab [1].
RP4 Origin of Transfer Sequences for Oligonucleotide Extension
name | oligonucleotide set | Reviewed by | Notes |
---|---|---|---|
oriT1_ob._na.1 | ctagaggaataagggacagtgaagaaggaacacccgctcg | NW | complement oriT4 |
oriT2_ob._na.1 | cgggtgggcctacttcacctatcctgcccggctgacgccg | NW | complement of oriT5 |
oriT3_ob._na.1 | ttggatacaccaaggaaagtctacatactagtagcggccgctgca | NW | complement of oriT6 |
oriT4_ob._na.1 | GCGGCCGCTACTAGTAtgtagactttccttggtg | NW | |
oriT5_ob._na.1 | tatccaacggcgtcagccgggcaggataggtgaagtaggcc | NW | |
oriT6_ob._na.1 | cacccgcgagcgggtgttccttcttcactgtcccttattcCT | NW |
BioBricks Extracted from Registry
name | Function | Combined with? |
---|---|---|
[http://partsregistry.org/Part:pSB1A7 pSB1A7] | high copy BioBrick vector, AmpR, insulated | Storage for oriV, oriT |
[http://partsregistry.org/Part:BBa_I51020 BBa_I51020] | BioBrick Base Vector | final assembly of all parts |
[http://partsregistry.org/Part:BBa_I14032 BBa_I14032] | lac promoter | rep region, aadA region |
[http://partsregistry.org/Part:BBa_B0034 BBa_B0034] | RBS PoPS=1.0 | rep region, aadA region |
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] | Double terminator | aadA region, P1 lytic region |
[http://partsregistry.org/Part:BBa_J23012 BBa_J23012] | aadA BioBrick | combine with lac promoter and double terminator |
Discussion
Make Parts
- I am making the parts several different ways: 1. PCR amplification, 2. synthetic construction of overlapping oligonucleotides, 3. extraction from BioBrick Registry.
PCR Amplification of pRL1383a
- Each of these experiments can be found at the link above. This will include amplification products from other plasmids besides pRL1383a.
Oligonucleotide Assemby
- The experiment and results can be found on the link above under the heading: "2 Construction of OriT from RP4 using Overlapping Oligonucleotides: Attempt 1"
Extraction of BioBrick Parts from Registry
- Some parts were extracted from BioBrick registry, the experiments and results will be included in the link above.
Ligation of Parts
- Experiments and results found in link above.
References
http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts Silver Lab, Overlapping Oligonucleotides Inserts Protocol.
[http://manoa.hawaii.edu/ ][http://manoa.hawaii.edu/ovcrge/
][http://www.ctahr.hawaii.edu
]