Team:Heidelberg/Notebook/Killing I/Notebook/week3
From 2008.igem.org
(→overview of the first phage cloning strategy) |
|||
(5 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
<html> | <html> | ||
- | <link | + | |
- | + | ||
- | + | <style> | |
+ | h1.firstHeading { display: none; } | ||
+ | |||
+ | p {text-align: justify;} | ||
+ | |||
+ | a:link { color: #00b0e6; text-decoration: none} | ||
+ | a:visited { color:#00b0e6; text-decoration: none} | ||
+ | a:hover { color:#f29400; text-decoration: none} | ||
+ | a:active { color:#f29400; text-decoration: none} | ||
+ | |||
+ | #bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; } | ||
+ | |||
+ | table#team_members { text-align: justify; border: 0; } | ||
+ | table#team_members h2, table#team_members h3 { clear: both; } | ||
+ | |||
+ | |||
+ | /*-----------------------------------------------------------------------------------------------*/ | ||
+ | div.MenuBar ul li ul.DropDownMenu { | ||
+ | display: none; /* Hides all drop-down menus. */ | ||
+ | |||
+ | } | ||
+ | /* | ||
+ | li:hover works in IE7 and FF2. | ||
+ | a:hover works in IE6 and FF2. | ||
+ | a:hover breaks li:hover in FF2. | ||
+ | */ | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu { | ||
+ | display: none; /* Hides all side menus. */ | ||
+ | } | ||
+ | /*------------------------------------------------------------------------------------- Menu Bar */ | ||
+ | div.MenuBar { | ||
+ | font: arial, helvetica, sans-serif; | ||
+ | height: 30px; | ||
+ | width: 910px; | ||
+ | /*width: 100%*/ | ||
+ | margin: 0; | ||
+ | border-top: 0; | ||
+ | border-right: 0; | ||
+ | border-left: 0; | ||
+ | padding: 0; | ||
+ | background: black; | ||
+ | |||
+ | } | ||
+ | div.MenuBar ul { | ||
+ | font: arial, helvetica, sans-serif; | ||
+ | text-align: center; | ||
+ | list-style-type: none; | ||
+ | margin: 0.5em auto; | ||
+ | border: 0; | ||
+ | padding: 0; | ||
+ | background: black; | ||
+ | } | ||
+ | div.MenuBar ul li { | ||
+ | font: arial, helvetica, sans-serif; | ||
+ | display: block; | ||
+ | padding: 0; | ||
+ | margin: 0; | ||
+ | font-size: 1.3em; | ||
+ | float: left; | ||
+ | background: black; | ||
+ | text-align: center; | ||
+ | width: 107px; | ||
+ | position: relative; /* Sets the positioning context for each drop-down menu. */ | ||
+ | } | ||
+ | |||
+ | div.MenuBar ul li a { | ||
+ | font: arial, helvetica, sans-serif; | ||
+ | display: block; | ||
+ | background: black; | ||
+ | height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */ | ||
+ | color: #ffffff; | ||
+ | padding-top: 4px; | ||
+ | padding-bottom: 4px; | ||
+ | padding-left: 1em; /* Sets the left space between top-level items. */ | ||
+ | padding-right: 1em; /* Sets the right space between top-level items. */ | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | |||
+ | /*------------------------------------------------------------------------------ Drop-Down Menus */ | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu { | ||
+ | display: block; | ||
+ | width: 10em; /* Drop-down menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | height: 1em; | ||
+ | padding: 1px; /* Sets the drop-down menu "effective border" width. */ | ||
+ | position: absolute; | ||
+ | top: 23px; /* Places the drop-down menu under the menu bar. | ||
+ | Keep it sync with the menu bar height. */ | ||
+ | left: 0; /* Aligns the drop-down menu to its top-level item. */ | ||
+ | background-color: black; /* Selected item. */ | ||
+ | color: #FFFFFF; | ||
+ | |||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a { | ||
+ | width: 10em; /* Keep it sync with the drop-down menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | height: 1em; | ||
+ | padding-left: 0; | ||
+ | padding-right: 0; | ||
+ | background-color: black; /* Selected item. */ | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | ul.DropDownMenu li a span { | ||
+ | display: block; | ||
+ | padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */ | ||
+ | padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */ | ||
+ | text-align: right; /* Aligns the >> symbol to the right. */ | ||
+ | } | ||
+ | ul.DropDownMenu li a span span { | ||
+ | float: left; /* Aligns the text (back) to the left. */ | ||
+ | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */ | ||
+ | height: 20px; | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | /*----------------------------------------------------------------------------------- Side Menus */ | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu { | ||
+ | display: block; | ||
+ | width: 11em; /* Side menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | padding: 1px; /* Sets the side menu "effective border" width. */ | ||
+ | position: absolute; | ||
+ | top: -1px; /* Aligns the side menu to its drop-down menu item. | ||
+ | Keep it sync with the side menu "effective border" width. */ | ||
+ | left: 13em; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a { | ||
+ | width: 11em; /* Keep it sync with the side menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */ | ||
+ | left: 13em; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | } | ||
+ | div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span { | ||
+ | padding-left: 1.5em; /* Sets the left space of each side menu item. */ | ||
+ | padding-right: 0.5em; /* Sets the right space of each side menu item. */ | ||
+ | text-align: left; | ||
+ | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */ | ||
+ | left: 13em; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. | ||
+ | Use MenuTailor.css to customize. */ | ||
+ | } | ||
+ | /*----------------------------------------------------------------------------- Browser Specific */ | ||
+ | * html div.MenuBar ul li a { | ||
+ | float: left; /* Required for IE55 and IE6. | ||
+ | Breaks O9. | ||
+ | Hidden (* html) from non-IE browsers. */ | ||
+ | } | ||
+ | * html ul.DropDownMenu li a:hover { | ||
+ | cursor: hand; /* Required for IE55. | ||
+ | Hidden (* html) from non-IE browsers. */ | ||
+ | } | ||
+ | ul.DropDownMenu li a:hover { | ||
+ | cursor: pointer; /* Required for IE6 and IE7. | ||
+ | Hidding it (* html) from non-IE browsers breaks IE7! | ||
+ | } | ||
+ | * html div.MenuBar a:hover { | ||
+ | text-decoration: none; /* Required for IE55 and IE6. | ||
+ | Hidden (* html) from non-IE browsers. */ | ||
+ | } | ||
+ | * html div.MenuBar ul li table, | ||
+ | * html div.MenuBar ul li table td { | ||
+ | border: 0; /* Required for IE55 and IE6. | ||
+ | Hidden (* html) from non-IE browsers. */ | ||
+ | } | ||
+ | /*------------------------------------------------------------------------------- Default Colors */ | ||
+ | div.MenuBar { | ||
+ | background-color: Menu; | ||
+ | border-bottom: 1px solid ButtonShadow; | ||
+ | } | ||
+ | div.MenuBar a { | ||
+ | background-color: Menu; /* Top-level unselected items. */ | ||
+ | color: MenuText; | ||
+ | } | ||
+ | div.MenuBar ul li:hover a, | ||
+ | div.MenuBar ul li a:hover { | ||
+ | color: #ea7f16; | ||
+ | background-color: Highlight; /* Top-level selected item. */ | ||
+ | color: HighlightText; | ||
+ | } | ||
+ | /*...............................................................................................*/ | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu { | ||
+ | background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */ | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a { | ||
+ | background-color: Menu; Drop-down menu unselected items. | ||
+ | Sets the drop-down menu "effective background" color. */ | ||
+ | color: MenuText; | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover { | ||
+ | background-color: Highlight; /* Drop-down menu selected item. */ | ||
+ | color: HighlightText; | ||
+ | } | ||
+ | /*...............................................................................................*/ | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu { | ||
+ | background-color: ButtonShadow; /* Sets the side menu "effective border" color. */ | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a { | ||
+ | background-color: Menu; /* Side menu unselected items. | ||
+ | Sets the side menu "effective background" color. */ | ||
+ | color: MenuText; | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover { | ||
+ | background-color: Highlight; /* Side menu selected item. */ | ||
+ | color: HighlightText; | ||
+ | } | ||
+ | /*-----------------------------------------------------------------------------------------------*/ | ||
+ | /*Script-Free 3-Level Menu 1.2 Tailor | ||
+ | www.CesarDaniel.info | ||
+ | /*-------------------------------------------------------------------------------------- General */ | ||
+ | body { | ||
+ | background: white; | ||
+ | color: black; | ||
+ | margin: 0; | ||
+ | border: 0; | ||
+ | padding: 0; | ||
+ | } | ||
+ | |||
+ | |||
+ | div.MenuBar { | ||
+ | font: 13px arial, helvetica, sans-serif; | ||
+ | } | ||
+ | div.MenuBar ul { | ||
+ | font: 13px arial, helvetica, sans-serif; /* Required for IE55. */ | ||
+ | } | ||
+ | /*--------------------------------------------------------------------------------------- Colors */ | ||
+ | div.MenuBar { | ||
+ | background-color: black; /* Selected item. */ | ||
+ | color: #FFFFFF; | ||
+ | border-bottom: 1px solid ButtonShadow; | ||
+ | } | ||
+ | div.MenuBar a, | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a, | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a { | ||
+ | background-color: black; /* Selected item. */ | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | div.MenuBar ul li:hover a, | ||
+ | div.MenuBar ul li a:hover, | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover a, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover, | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover { | ||
+ | background-color: #00b0e6; /* Selected item. */ | ||
+ | color: #FFFFFF; | ||
+ | } | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu, | ||
+ | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu, | ||
+ | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu { | ||
+ | background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */ | ||
+ | } | ||
+ | /*--------------------------------------------------------------------------------------- Widths */ | ||
+ | /* | ||
+ | |||
+ | /* | ||
+ | Menu Bar 1 | ||
+ | Drop-Down Menu #2 | ||
+ | */ | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4, | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a { | ||
+ | width: 11em; /* Drop-down menu width. */ | ||
+ | } | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5, | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a { | ||
+ | width: 12em; /* Drop-down menu width. */ | ||
+ | } | ||
+ | |||
+ | /*...............................................................................................*/ | ||
+ | /* | ||
+ | Menu Bar 1 | ||
+ | Drop-Down Menu #2 | ||
+ | Side Menu #1 | ||
+ | */ | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 { | ||
+ | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. */ | ||
+ | } | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1, | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a { | ||
+ | width: 10em; /* Side menu width. */ | ||
+ | } | ||
+ | /*...............................................................................................*/ | ||
+ | /* | ||
+ | Menu Bar 1 | ||
+ | Drop-Down Menu #2 | ||
+ | Side Menu #2 | ||
+ | */ | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 { | ||
+ | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. */ | ||
+ | } | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2, | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a { | ||
+ | width: 10em; /* Side menu width. */ | ||
+ | } | ||
+ | /*...............................................................................................*/ | ||
+ | /* | ||
+ | Menu Bar 1 | ||
+ | Drop-Down Menu #2 | ||
+ | Side Menu #3 | ||
+ | */ | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 { | ||
+ | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu. | ||
+ | Keep it sync with the drop-down menu width. */ | ||
+ | } | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3, | ||
+ | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a, | ||
+ | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a { | ||
+ | width: 10em; /* Side menu width. */ | ||
+ | } | ||
+ | /*...............................................................................................*/ | ||
+ | |||
+ | </style> | ||
+ | |||
<body> | <body> | ||
Line 52: | Line 393: | ||
</li> | </li> | ||
<li> | <li> | ||
- | <a href="https://2008.igem.org/Team:Heidelberg/ | + | <a href="https://2008.igem.org/Team:Heidelberg/Modeling" style="color: white">Modeling<!--[if gt IE 6]><!--></a><!--<![endif]--> |
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | ||
<ul class="DropDownMenu" id="MB1-DDM3"> | <ul class="DropDownMenu" id="MB1-DDM3"> | ||
Line 62: | Line 403: | ||
</li> | </li> | ||
<li> | <li> | ||
- | <a href="https://2008.igem.org/Team:Heidelberg/Notebook/ | + | <a href="https://2008.igem.org/Team:Heidelberg/Notebook/Overview" style="color: white">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]--> |
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | ||
<ul class="DropDownMenu" id="MB1-DDM5"> | <ul class="DropDownMenu" id="MB1-DDM5"> | ||
Line 98: | Line 439: | ||
</li> | </li> | ||
<li style="width: 160px"> | <li style="width: 160px"> | ||
- | <a href="https://2008.igem.org/Team:Heidelberg/ | + | <a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Project_Overview" style="color: white">Human Practice<!--[if gt IE 6]><!--></a><!--<![endif]--> |
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--> | ||
<ul class="DropDownMenu" id="MB1-DDM4"> | <ul class="DropDownMenu" id="MB1-DDM4"> | ||
Line 106: | Line 447: | ||
<li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Surveys"><span><span>Surveys</span></span></a></li> | <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Surveys"><span><span>Surveys</span></span></a></li> | ||
<li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Open_Day"><span><span>Open Day</span></span></a></li> | <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Open_Day"><span><span>Open Day</span></span></a></li> | ||
- | <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Nobel_Prize"><span><span>Nobel Prize</span></span></a></li> | + | <li><a href="https://2008.igem.org/Team:Heidelberg/Human_Practice/Nobel_Prize"><span><span>Nobel Prize</span></span></a></li> |
+ | |||
</ul> | </ul> | ||
<!--[if lte IE 6]></td></tr></table></a><![endif]--> | <!--[if lte IE 6]></td></tr></table></a><![endif]--> | ||
Line 121: | Line 463: | ||
</html> | </html> | ||
+ | {| class="wikitable" | ||
+ | |- bgcolor=white | ||
+ | ! height=20px, width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week2|<< Week 2]]|| width=500px | [[Team:Heidelberg/Notebook/Killing_I/Notebook|Overview]]|| width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week4| Week 4 >> ]] | ||
+ | |-style="height:20px" | ||
+ | |} | ||
- | |||
+ | '''Week 3''' | ||
==Monday, 08/18/08== | ==Monday, 08/18/08== | ||
Line 165: | Line 512: | ||
** Analytical digestion of cI "green", cI "black" and T9002 | ** Analytical digestion of cI "green", cI "black" and T9002 | ||
- | *Gel | + | *Gel |
[[Image:Hd-phage-08-08-19-digestion.jpg]] | [[Image:Hd-phage-08-08-19-digestion.jpg]] | ||
#* Lane 0: DNA ladder mix | #* Lane 0: DNA ladder mix | ||
Line 197: | Line 544: | ||
[[Image:Hd-phage-wachstumskurve_errorbars_small.jpg]] | [[Image:Hd-phage-wachstumskurve_errorbars_small.jpg]] | ||
**the values are the average of all four cultures | **the values are the average of all four cultures | ||
- | + | ||
Line 223: | Line 570: | ||
===project planning=== | ===project planning=== | ||
- | Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :) | + | Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :) |
- | + | ||
I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make | I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make | ||
fresh plasmid preps. | fresh plasmid preps. | ||
- | + | ||
pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307. | pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307. | ||
- | + | ||
pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the | pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the | ||
RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently | RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently | ||
mobilised by pUB307. | mobilised by pUB307. | ||
- | + | ||
I would think cloning this 690 bp fragment into your lambda vector would be the simplest | I would think cloning this 690 bp fragment into your lambda vector would be the simplest | ||
solution; its small and will mobilise in the presence of just pUB307. | solution; its small and will mobilise in the presence of just pUB307. | ||
- | + | ||
Keith | Keith | ||
- | + | ||
Line 287: | Line 634: | ||
- | ===overview of the | + | ===overview of the phage cloning strategy one=== |
<br> | <br> | ||
[[Image:Hd-phage-Klonierungsstrategie_Page_1.jpg]] | [[Image:Hd-phage-Klonierungsstrategie_Page_1.jpg]] | ||
Line 295: | Line 642: | ||
[[Image:Hd-phage-Klonierungsstrategie_Page_3.jpg]] | [[Image:Hd-phage-Klonierungsstrategie_Page_3.jpg]] | ||
<br><br><br> | <br><br><br> | ||
- | + | ||
- | + | ||
<br><br><br> | <br><br><br> | ||
Used primer sequences: | Used primer sequences: | ||
- | + | ||
oriT_RP4_fw (Tm=62°C): | oriT_RP4_fw (Tm=62°C): | ||
Line 306: | Line 652: | ||
CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc | CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc | ||
- | + | ||
oriT_RP4_rv: (Tm=58°C) | oriT_RP4_rv: (Tm=58°C) | ||
TATTCGGGTACCgtcccctcagttcagtaatttcctgc | TATTCGGGTACCgtcccctcagttcagtaatttcctgc | ||
- | + | ||
GFP_CmR_fw: (Tm=56°C) | GFP_CmR_fw: (Tm=56°C) | ||
CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg | CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg | ||
- | + | ||
GFP_CmR_rv: (Tm=55°C) | GFP_CmR_rv: (Tm=55°C) | ||
TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc | TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc | ||
- | + | ||
GAM_fw: (Tm=55°C) | GAM_fw: (Tm=55°C) | ||
AGTGCTTTAGCGTTAACTTCCG | AGTGCTTTAGCGTTAACTTCCG | ||
- | + | ||
GAM_rv: (Tm=53°C) | GAM_rv: (Tm=53°C) | ||
GGTTTTACCGCATACCAATAACG | GGTTTTACCGCATACCAATAACG | ||
- | + | ||
CmR_fw: (Tm=54°C) | CmR_fw: (Tm=54°C) | ||
gctaaaATGgagaaaaaaatcactgg | gctaaaATGgagaaaaaaatcactgg | ||
- | + | ||
CmR_rv: (Tm=58°C) | CmR_rv: (Tm=58°C) | ||
AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC | AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC | ||
- | |||
- | |||
- | |||
- | |||
- | |||
==Thursday, 08/21/08== | ==Thursday, 08/21/08== | ||
Line 459: | Line 800: | ||
** large fragment 1: 14,4 ng/µl; 1,99 | ** large fragment 1: 14,4 ng/µl; 1,99 | ||
** large fragment 1: 16,8 ng/µl; 2,14 | ** large fragment 1: 16,8 ng/µl; 2,14 | ||
+ | |||
+ | |||
+ | |||
+ | {| class="wikitable" | ||
+ | |- bgcolor=white | ||
+ | ! height=20px, width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week2|<< Week 2]]|| width=500px | [[Team:Heidelberg/Notebook/Killing_I/Notebook|Overview]]|| width=250px | [[Team:Heidelberg/Notebook/Killing_I/Notebook/week4| Week 4 >> ]] | ||
+ | |-style="height:20px" | ||
+ | |} |
Latest revision as of 11:34, 29 October 2008
<< Week 2 | Overview | Week 4 >> |
---|
Week 3
Contents |
Monday, 08/18/08
chloramphenicol resistance cassette
- Maxiprep of P1000, P1004, B0014, B0015
- P1000 1672 ng/µl 1,92
- P1004 1153 ng/µl 1,92
- B0014 2040,4 ng/µl 1,92
- B0015 1053,6 ng/µl 1,92
- Analytical digestions
- lambda DNA with XbaI and XhoI
2µl DNA 5µl NEB2 5µl BSA 1µl XbaI 1µl XhoI 26µl water
- Analytical digestion of P1000
1µl DNA 2µl NEB3 2µl NcoI 15µl water
- Analytical digestion of P1004
1µl DNA 2µl NEB4 1,5µl DraI 15,5µl water
- Analytical digestion of B0014 / B0015
1µl DNA 2µl NEB4 2µl BSA 2,5µl SfcI 12,5µl water
- Analytical digestion of cI "green", cI "black" and T9002
- Gel
- Lane 0: DNA ladder mix
- Lane 1: lambda DNA
- Lane 2: lambda DNA (XbaI, XhoI --> large frament ~ 40kb, small fragment ~ 9kb)
- Lane 3: P1000
- Lane 4: P1000 (NcoI-->1473,2374)
- Lane 5: P1004
- Lane 6: P1004 (DraI-->19,339,692,1067,1360)
- Lane 7: cI green
- Lane 8: cI green (NdeI - expected fragments?)
- Lane 9: cI black
- Lane 10: cI black (NdeI)
- Lane 11: T9002
- Lane 12: T9002 (NdeI - expected fragments?)
lamda phage
Infectiontest
- inoculation of 20ml medium with over night culture (MG1655)
- after 1h plaque added --> 37C for 2h + inoculation of ZMBH phage (100ql 10^-2 in 20ml MG1655)
- incubation at 42C for 2 more hours
- sterilefiltration + mix with growing bacteria (MG1655 and MG1655+cI)
- incubate in soft agar at 37C for 2h, than at 42C for another 4h (altogether 24 plates)
- phage DNA was also isolated from filtrate
- results:
- same amount of plaques on plates with MG1655 as with MG1655+cI
- nearly no plaques on plates with own phage --> very low phage concentration
- --> cI does not work!!!!
- growing curve
- the values are the average of all four cultures
Tuesday, 08/19/08
lambda phage
- Digestion of lambda DNA with XbaI and XhoI
- very nice separation of the small fragment from the two large fragments (one band) picture of the gel was not saved but it looked very nice
- cutting out of the small and large fragment --> gel purification kit
- small fragment: 30,3 ng/µl; 1,86
- large fragment1: 19,5 ng/µl; 2,11
- large fragment2: 61,5ng/µl; 1,90
GFP
- inoculation of three overnight cultures from the two I20260 glycerol stocks
chloramphenicol resistance cassette
- Transformation of P1000, P1004 (both chloramphenicol resistances) and CI
- no success
project planning
Guys, we received this email by another professor in the states. sounds good. we should get this helper plasmids in the end :)
I have sent pUB307, RSF1010, pED350, pED361, which are described in our two MGG papers. Also two clones I made of the oriT from RP1; pED369 and pED374. There are 10microl of each. The DNAs are old (1983!) and so I would transform and make fresh plasmid preps.
pED350 is oriT+ and Mob+, so it is efficiently mobilised by RPI or its derivative pUB307. pED361 is oriT+ only. It cannot be mobilised by pUB307 as it lacks mob functions. If RSF1010 is also in the cell pKD361 is very efficiently mobilised by pUB307.
pED369 and pED374 are two subclones I made of the RP1 oriT into pED825 (Amp resistant described in MGG papers). pED374 contains a single 690 bp HaeII fragment containing the RP1 oriT. PED369 contains the 690 bp oriT fragment plus additional HaeII fragments. I sent both just in case the pED374 DNA does not check out. These are efficiently mobilised by pUB307.
I would think cloning this 690 bp fragment into your lambda vector would be the simplest solution; its small and will mobilise in the presence of just pUB307.
Keith
Wednesday, 08/20/08
GFP
- Miniprep of reference promotor I20260
- Concentrations:
- Epi1 9,8 ng/ul; 2,52
- Epi2 15,7 ng/ul; 2,28
- Epi3 19,7 ng/ul; 1,93
- Concentrations:
- Digestion of I20260
10 µl DNA (from Epi3) 2ul SmlI 12µl NEB4 2ul BSA 10x 4 µl water
- Digestion of the XbaI-XhoI fragment with AgeI
18 µl DNA (from gel purification kit) 5 µl AgeI 5 µl NEB4 22 µl water
- Gel
- Lane 0: DNA ladder mix
- Lane 1: I20260 (SmlI-->251bp, 373bp, 843bp, 918bp, 1284bp)
- Lane 2: XbaI-XhoI fragment (AgeI-->1.7kb, 7.3kb)
- Lane 3: large lambda DNA fragments 3µl (15kb, 24.5kb)
- Results:
- I20260 seems not to be correct, inoculate overnight cultures from the glycerol stocks again
- digestion of the XbaI-XhoI fragment with AgeI did not work good, only the 7.3kb fragment can be seen, reasons: wrong buffer concentration, too much enzyme (glycerol) in the reaction
- large lambda DNA fragment is looking good
lambda phage
- concentrations of lambda-DNA extractions
- from Fermentas Phage - plaque 1: 7.5 ng/ul; 1.86
- from Fermentas Phage - plaque 2: 61.5 ng/ul 1.90
- from ZMBH phage 19,7 ng/ul 2,11
overview of the phage cloning strategy one
Used primer sequences:
oriT_RP4_fw (Tm=62°C):
CTCGTTTCTAGAACTAGTgacaggctcatgccggccgc
oriT_RP4_rv: (Tm=58°C)
TATTCGGGTACCgtcccctcagttcagtaatttcctgc
GFP_CmR_fw: (Tm=56°C)
CTCGTTGGTACCTCTAGAtttacagctagctcagtcctagg
GFP_CmR_rv: (Tm=55°C)
TATTCGACCGGTACTAGTtataaacgcagaaaggcccacc
GAM_fw: (Tm=55°C)
AGTGCTTTAGCGTTAACTTCCG
GAM_rv: (Tm=53°C)
GGTTTTACCGCATACCAATAACG
CmR_fw: (Tm=54°C)
gctaaaATGgagaaaaaaatcactgg
CmR_rv: (Tm=58°C)
AGGTTCTCCTTTATTAGCCGGATCCTCTAGATTACGCC
Thursday, 08/21/08
lambda phae
- Preparative digestion of lambda-DNA from Fermentas
10µl DNA = 3 ug 2µl XhoI 2µl XbaI 5µl NEB 2 5µl BSA 33µl H20
- lambda DNA "2" and "ZMBH" from phage extraction kit
36 µl DNA 2 µl XhoI 2µl XbaI 5µl NEB 2 5 µl BSA
- all digestions 3h, 400rpm, 37°
- Gel
- lane 0: DNA ladder mix
- lane 2: lambda DNA (fermentas) (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 4: lambda DNA from extraction "2" (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 6: lambda DNA from extraction "ZMBH phage" (XbaI, XhoI --> ~40 kb, ~9 kb)
- lane 2, 4 and 6 overflowed
- cutting out of the XbaI-XhoI fragment from lane 2
- the large fragment wasn't cutted out because the gel was exposed to UV light over 30 seconds
- gel extraction kit
- DNA eluted in 20µl
- Digestion of the XbaI-XhoI fragment with AgeI
20µl DNA (from gel purification kit) 2µl AgeI 5µl NEB4 23µl water
- 16°C over night
- Preparative digestion of lambda-DNA from Fermentas
10µl DNA = 3 µg 2µl XhoI 2µl XbaI 5µl NEB 2 5µl BSA 33µl water
- 16°C over night
GFP
- Miniprep from overnight cultures of I20260 glycerol stocks
- eluted in 50 µl
- Concentrations:
- Miniprep 1: 19.8 ng/µl
- Miniprep 2: 17.4 ng/µl
- Miniprep 3: 19.0 ng/µl
- Miniprep 4: 16.4 ng/µl
- Analytical digestion of the four I20260 Minipreps
- 20µl DNA
- 5µl NEB 4
- 1.5µl DraI
- 23.5µl water
- Gel
- lane 0: DNA ladder
- lane 1: I20260 1
- lane 2: I20260 1 (DraI-->19bp, 535bp, 886bp, 2229bp)
- lane 3: I20260 2
- lane 4: I20260 2 (DraI)
- lane 5: I20260 3
- lane 6: I20260 3 (DraI)
- lane 7: I20260 4 (DraI)
- Results
- it seems that we have I20260, inoculation of an overnight culture from I2020 No. 3 for Maxiprep
- Results
- Transformation of I20260 (Kan) (from the promotor measurement kit sheet as well as from the registry) and J01101 (Amp)
- eluted in 10µl water
- transformed into TOP10 and MG1655 (each 4µl DNA)
cI
- ordered J01101 (cI) from the iGEM headquater, they will already send it today
Friday, 08/22/08
GFP
- Maxiprep of reference promotor I20260
- concentrations: 200 ng/µl
lambda phage
- Gel: Digestions of lambda-DNA (fermentas), and the small XbaI-XhoI fragments
- lane 1: DNA ladder mix
- lane 3: lambda-DNA (XbaI, XhoI; ~ 40kb, ~ 9kb)
- lane 5: small lambda-fragment assayI (AgeI, ~1,7kb, ~7,3kb)
- lane 7: small lambda-fragment assayII (AgeI, ~1,7kb, ~7,3kb)
- Extraction of XbaI-XhoI fragments (evaluation of samples with nanodrop)
- small fragment 1: 15,9 ng/µl; 2,41
- small fragment 2: 6,6 ng/µl; 2,02
- large fragment 1: 14,1 ng/µl; 2,75
- large fragment 1: 10,8 ng/µl; 2,86
- large fragment 1: 14,4 ng/µl; 1,99
- large fragment 1: 16,8 ng/µl; 2,14
<< Week 2 | Overview | Week 4 >> |
---|