"
Team:KULeuven/Primers
From 2008.igem.org
(Difference between revisions)
m |
m |
||
| Line 1: | Line 1: | ||
| - | {{:Team:KULeuven/Tools/ | + | {{:Team:KULeuven/Tools/Header}} |
{|cellspacing="1" width=100% | {|cellspacing="1" width=100% | ||
Revision as of 14:39, 30 July 2008
dock/undock dropdown
| Table of Oligos | |||||
|---|---|---|---|---|---|
| Number | Name | Sequence | Length | Comments | |
| 1 | T7 Fw, no tag | catcatgaattcgcggccgcttctagatgaacacgattaacatcgc | 46bp | {{{Tm}}} | Forward T7 RNApol primer, without UmuD tag |
| 2 | T7 Rev | ctgcagcggccgctactagtattattacgcgaacgcgaagtccg | 44bp | {{{Tm}}} | Reverse T7 RNApol primer |
| 3 | T7 Fw, UmuD tag, part 1 | ccgctatttagcgatcttgttcagtgtggctttccttcaccgatgaacacgattaacatcgc | 62bp | {{{Tm}}} | Forward T7 RNApol primer, with UmuD tag, part 1 |
| 4 | T7 Tw, UmuD tag, part 2 | catcatgaattcgcggccgcttctagatgttgtttatcaagcctgcggatctccgcgaaattgtgacttttccgctatttagcgatcttgttcag | 95bp | {{{Tm}}} | Forward T7 RNApol primer, with UmuD tag, part 2, very expensive |
| 5 | GFP-LVA Fw | catcatgaattcgcggccgcttctagatgcgtaaaggagaagaacttttcactgg | 55bp | {{{Tm}}} | Forward GFP-LVA primer |
| 6 | GFP-LVA Rev | ctgcagcggccgctactagtattattaagctactaaagcgtagttttcgtcgtttgcagcaggc | 64bp | {{{Tm}}} | Reverse GFP-LVA primer |
| 7 | VF2 | TGCCACCTGACGTCTAAGAA | 20bp | {{{Tm}}} | Forward primer for sequence analysis |
| 8 | VR | ATTACCGCCTTTGAGTGAGC | 20bp | {{{Tm}}} | Reverse primer for sequence analysis |
