Team:LCG-UNAM-Mexico/Notebook/2008-June 2

From 2008.igem.org

(Difference between revisions)

Revision as of 19:44, 27 October 2008

LCG-UNAM-Mexico:Notebook/June_2

LCG-UNAM-Mexico

iGEM 2008 TEAM

June

2008-06-18

Final design

Scheme

The first plasmid contains the efflux pump for Nickel (RcnA), which will maintain its natural regulation dependent of RcnR and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI as well as a resistance as a marker of the plasmid.

The second plasmid contains everything needed for regulating RcnA dependent on an external signal (AHL). Both luxR and aiiA will be synthesised constitutively. LuxR with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting and aiiA under the control of a moderate or weak promoter (pLacZ) for it is a very efficient enzyme, and we don't want it to degrade all AHL and prevent the signal from being transmitted. And cI*, which is a version of cI tagged with an LVA tail for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain a resistance as a marker.

When AHL is added, it will bind LuxR and stimulate the production of cI*, which in turn will represses the transcription of rcnA. Like cI*, the signal produced by AHL will be short-lived since aiiA will be degradating it constantly, so the system quickly returns to its initial state.

Parts
Defining bioparts we will use or where to get what is necessary.

Part: BBa_I729006

Part of Quorum sensing used by the team Chiba in iGEM2007. Both tetR and LacI + pL are constitutive promoters, but since LacI + pL is a very strong promoter, it will probably be replaced. This biopart will be responsible for the regulation by luxR and the action of the system by AHL. Instead of GFP (Subpart E0040), the BBa_C0051 part that codes for the protein cI + LVA will be inserted, which will join the regulatory region of cI (biopart BBa_R0051) in the other plasmid.

(Previous experience: none)

Part:BBa_C0051

Region coding for the repressor cI, of lambda phage, tagged with an LVA tail for rapid degradation. cI joins the regulator cI (BBa_R0051)

(Previous experience: none)

Part:BBa_R0051

Promoter regulated by cI based on the pR promoter of lambda phage. The promoter has two binding sites for the cI repressor of lambda phage (BBa_C0051). The binding of cI leads to the suppression of the transcript synthesis.

(Previous experience: it works)

The sequence of the 3 previously mentioned bioparts is in the Registry of Standard Biological Parts and according to the information provided by the registry, DNA is available.

Part: BBa_G00510

gatttctgcatagccagacttggg

This is the forward primer for C0051, 24 bp long.

Part: BBa_G00511

cactgactagcgataactttccccac

Reverse primer for C0051, 26 bp long.

Vectors

Possibilities in bioparts:

Name	Description
pSB3C5	Low to medium copy BioBrick standard vector
pSB3T5	Low to medium copy BioBrick standard vector
pSB4A3	pSB4A3
pSB4C5	Low copy BioBrick standard vector
pSB4A1	pSB4A1
pSB4A5	Low copy BioBrick standard vector
pSB4T5	Low copy BioBrick standard vector
BBa_I739202	pCK01BB1

Primers

Build or find oligos that we could use for our constructions.

We need:
• rcnA (with its regulatory region; no promoter).
• cI* with its AHL-LuxR dependent promoter.
• LuxR with its constitutive tetR promoter.
• AiiA with its constitutive promoter (lac is proposed, it is a moderate promoter).
• Promoter dependent of cI.
In all cases, we have to check whether they already exist (in bioparts or elsewhere) and evaluate them.

		Sequence	Tm	Deg.	Restr. Site	Bioparts
(pTetR)luxR/(p.c.strong)aiiA	Upper		62.5 ºC	1	None	?
Lower		63.8 ºC	1	None	?
pcI	Upper		61.9-76.2 ºC	864	None	?
pcI	Lower		66.5 ºC	1	None	?
pLacZ	Upper	5' GCACCCAGGCTTTACACTTT 3'	64.7 ºC	1	None	?
pLacZ	Lower	5' TGTTATCCGCTCACAATTCCA 3'	60.3 ºC	1	None	?
cI*	Upper	5' GATTTCTGCATAGCCAGACTTGGG 3'	62.9 ºC	1	None	BBa_G00510
cI*	Lower	5' CACTGACTAGCGATAACTTTCCCCAC 3'	61.9 ºC	1	None	BBa_G00511
rcnA	Upper	5' CACTATTAATCTACTGGGGGGTAG3'	64.2ºC	1	None
rcnA	Lower	5' AGTTATCGCATTATGCCCATG 3'	65.8ºC	1	None

Promoters

Investigate more about the proposed promoters and define if they are the most optimal depending on our needs.

Promoter	Biopart	Constitutive?	Strength	Notes
pTetR	BBa_R0040	In tetracycline presence or TetR absence	medium	Recomended by our advisor Miguel
pLuxR-HSL	BBa_R0062	Over-regulated by LuxR-HSL (increases its expression).	weak (constitutive)/medium (LuxR-HSL)	luxR could bring some trouble if it becomes a part of the sistem
pLacIQ	BBA_I14032	Yes	high	¿Is there a biopart? It could be the promoter for luxR
pCyc	BBa_I766555	Yes	medium	Yeast promoter
J23112	BBa_J23113	Yes	1
J23103	BBa_J23113	Yes	17
J23113	BBa_J23113	Yes	21
J23109	BBa_J23113	Yes	106
J23117	BBa_J23113	Yes	162
J23114	BBa_J23113	Yes	256
J23115	BBa_J23113	Yes	387
J23116	BBa_J23113	Yes	396	Constitutive promoters family
J23105	BBa_J23113	Yes	62	Constitutive promoters family
J23110	BBa_J23113	Yes	844
J23107	BBa_J23113	Yes	908
J23106	BBa_J23113	Yes	1185
J23108	BBa_J23113	Yes	1303
J23118	BBa_J23113	Yes	1429
J23111	BBa_J23113	Yes	1487
J23101	BBa_J23113	Yes	1791
J23104	BBa_J23113	Yes	1831
J23102	BBa_J23113	Yes	2179
J23100	BBa_J23113	Yes	2547

Facts about kinetics & other things...

Investigate more about the elements of the system to begin building an outline for the model and defining if design is theoretically feasible.

NOTES: For LuxR to bind HSL and enable the transcription of cI, HLS should be at a micromolar concentration.
Not all bioparts have been previously used, most DNA is available but there is still no record their functionality. We need to evaluate the DNA quality to ensure that there will be no problems.

2008-06-24

Modeling

Variables
Concentrations of:

LuxR (constant).

aiiA (constant).

AHL (arbitrary).

cI* (according to aiiA, AHL & LuxR).

RcnA (according to cI*).

We need to determine the initial concentrations and lifetime of proteins involved, as well as the efficiency of AiiA (kinetics in general).
The concentration of Nickel (NiCl2) in the medium that the cells can tolerate according to Rodrigue et al. (2005) before inhibiting growth is 4 μ M for the strain lacking rcnA, 10 μM in the wildtype and up to 100-fold more in a strain with a multicopy gene.

	Concentration	Life span (half-life)	Substrate affinity	Notes
AHL	?	3 hrs.	?	Conflictive information
LuxR	?	60 min- (~40-100)	?
LuxR	?	2 min (35 min +AHL)	?
aiiA	?	24 hrs	?
cI*	?	?	?
RcnA	?	?	?

Assumption 1: Once there is nickel in the medium, RcnR will not interfere in the pump regulation. This because there will be large concentrations of metal, so we can assume that RcnR will always be bound to a molecule of nickel and it will therefore be unable to suppress the transcription of rcnA; the noise that the few RcnR free molecules can cause, will be indistinguishable from normal behaviour of the pump.

Assumption 2: Any decrease in the concentration of AHL is due to aiiA. It is believed that the natural degradation of this molecule is irrelevant in the time scale analysis. Either way, a process will not be distinguishable from the other and even when the first is estimated, it would not be very informative for the analysis, so we intend to take this assumption as true.

Assumption 3: The transcription of cI* depends solely on the concentration of AHL. LuxR is not a limiting step, ie, it is in a constant concentration and in sufficient amount to always be ready to associate with AHL. Only to simplify the analysis, at least for our first approach.

Initial outline:

(v1) AHL0
(v2) aiiA + AHL -> aiiA
(v3) AHL + LuxR -> cI*
(v4,v5) ρ + cI* <--> ρ.cI*
ρ -> ρ +RcnA
RcnA + Ni -> RcnA
RcnA -> Ø

2008-06-26

Wet Lab/strong>

1. Take the sequences (fasta format)
2. Once you have the sequence find appropriate reading frames
3. Make the restriction map
-- Nedcutter, check the page for NewEngland Biolabs (because we are going to use enzymes from that company)
For rcnA and rcnR, the regulatory region that was among the two genes was not explained.
We have to take the whole sequence in fasta format and use it in a program called Gene Construction Kit. This shows reading frames and restriction sites.

In fruitfly.org: 9005/seq_tools/promoter.html we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program "repeat". For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.

Primer design. The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm.

The most popular program at the center is Oligo. Here we open a new window and paste the sequence. This will open two windows. The first one with the Tm, and the other one with the free energy. The program can calculate all oligos and show potential couples with its parameters. We can also specify were we want the oligo to be located. Once the program generates it, we can analyze its biochemical properties.

Trying to k Delta G so it won't be lower than -10.

The differences between the TMS should not be greater than 5 degrees. Enzymes used in PCR use magnesium chloride. The most reliable and processed use magnesium acetate. It is said that 10mM of dinucleotidos is an optimal concentration for PCR, .4 mM is used in the lab. Once we have the oligo, we add a site at the far restraining 5 '. And add nucleotides in the 5 'end to ensure that the enzyme is positioned correctly and efficiently cut. These nucleotides are different for each enzyme, and they also protect the 5' end.

Two plasmids are used as a basis prK415 P. Our advisor, Miguel, already has isolated DNA and this DNA will be used to transform and to have a the plasmid reserved. 2ul of the plasmid and competent cells treated with calcium chloride. The theory says that positive ions are attached to the membrane, so the membrane has a positive charge. As DNA has a negative charge, once they are mixed at 4 degrees Celsius for 20 minutes, we are going to take the tube and put it at 42 degrees centigrade. This stress produces holes in the membrane and many things will be capable or entering or exiting through the membrane, including DNA. Then it remains 2 more minutes at this temperature. The we return it to ice for 5 more minutes to recover. Later, the cells are placed in 1ml of rich medium (LB) were they are allowed to grow at 37 degrees for one hour at 300 revolutions per minute (this allows them to recover).

100ul are taken and used to plate in petri dishes with the antibiotic. It is left to grow for an entire day and at the end, isolated colonies should appear.
Bacteria with kanamycin 5ml of two strains, one with a deletion in rcnA and another one with any deletion except for rcnA . For 6 hours, the bacteria will have an exponential growth. Genomic DNA will be extracted.

The contents of the tube will be put in an eppendorf, we centrifuge and then we withdraw the liquid medium with a syringe. Before we lyse de cells, we need to wash with TE 10 1 (Tris 10uM EDTA 1uM), with pH 8. Vortex, to separate and disintegrate. Again, we centrifuge and remove supernatant. To lyse, we add 400-450 ul TE5020pH8 and SDS 10% and K proteinase. We leave it at 37 degrees for 20 minutes. The medium goes from an opaque color to a light color when lysis happens. We add ethanol 100% once we have lysed the cells and we vortex. In the presence of ethanol DNA is precipitated, so we add 1ml of ethanol. Then we centrifuge for a few minutes and we have pellet. We wash three times with ethanol 70%, which solubilised salts and the small molecules (including RNA). We remove all the ethanol, this tube is placed in a specific centrifuge. The vacuum from this centrifuge will remove the remain solvent. It is necessary to remove all the ethanol, because this affects the pH. TE 10 1 RNAs 10mg per ml, this Stock solution is divided 1000 times and 50ul approx are added. To check the quality of the DNA extracted, we use an agarose gel.

Transforming bioparts: Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.

@@ Line 127: / Line 127: @@
 </div>
 <p align="center"><br /></p>
-<p>The first plasmid contains the efflux pump for Nickel (rcnA), which  will maintain its natural regulation dependent of RcnR and  additionally, it will contain a promoter regulated by the repressor of lambda  phage, cI. In addition of a resistance as a marker of the plasmid. </p>
+<p>The first plasmid contains the efflux pump for Nickel (RcnA), which  will maintain its natural regulation dependent of RcnR and  additionally, it will contain a promoter regulated by the repressor of lambda  phage, cI as well as a resistance as a marker of the plasmid. </p>
 <p>
-   The second plasmid contains everything needed for regulating RcnA dependent on an external signal (AHL). Both luxR as aiiA will be synthesised constitutively, the first one, with a strong promoter (pTetR), as we do  not want the presence of LuxR to be limiting, and the second one, having a moderate or weak promoter (pLacZ), to give us space to play with concentrations of AHL without aiiA always degrading it all. And cI *, cI modified with an LVA tail for rapid degradation, regulated by a promoter dependent of LuxR +  AHL. It will also contain a resistance as a marker.   </p>
+   The second plasmid contains everything needed for regulating RcnA dependent on an external signal (AHL). Both luxR and aiiA will be synthesised constitutively. LuxR with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting and aiiA under the control of a moderate or weak promoter (pLacZ) for it is a very efficient enzyme, and we don't want it to degrade all AHL and prevent the signal from being transmitted. And cI*, which is a version of cI tagged with an LVA tail for rapid degradation, regulated by a promoter dependent of LuxR +  AHL. It will also contain a resistance as a marker.   </p>
 <p>
-   When AHL is added, it will join LuxR and induce the production of cI *, which in  turn represses the transcription of rcnA. Like cI *, the signal produced by AHL will be short-lived since aiiA is degradating it constantly, so the system quickly returns to its initial state.   <br />
+   When AHL is added, it will bind LuxR and stimulate the production of cI*, which in  turn will represses the transcription of rcnA. Like cI*, the signal produced by AHL will be short-lived since aiiA will be degradating it constantly, so the system quickly returns to its initial state.   <br />
    <br />
    <strong>Parts </strong><br />
-  <br />
    Defining bioparts we will use or where to get what is necessary. <br />
-   <em><br />
+   <br />
-   <strong>Part: BBa_I729006</strong></em></p>
+   <li><strong><i>Part: BBa_I729006</strong></i></li></p>
 <p><div id="pbfw">
    <div id="ub_r">
@@ Line 143: / Line 142: @@
    </div>
 </div>
-<p align="center"><br /></p>
+<p align="center"></p>
 <p>Part of Quorum sensing used by the team Chiba in iGEM2007. Both tetR  and LacI + pL are constitutive promoters, but since LacI + pL is  a very strong promoter, it will probably be replaced. This biopart will be  responsible for the regulation by luxR  and the action of the system by AHL.  Instead of GFP (Subpart E0040), the BBa_C0051 part that  codes for the protein cI + LVA will be inserted, which will join the regulatory region of cI  (biopart BBa_R0051) in the other plasmid.</p>
-<p>(Previous experience: none)</p>
+<p>(Previous experience: none)</p><br>
-<p><strong><em>Part:BBa_C0051</em></strong></p>
+<p><li><strong><em>Part:BBa_C0051</em></strong></li></p>
 <p><div id="pbfw">
    <div id="ub_r">
@@ Line 154: / Line 153: @@
    </div>
 </div>
-<p align="center"><br /></p>
+<p align="center"></p>
-<p>Region coding for the repressor cI based on the repressor cI of lambda  phage with modified LVA with a queue for rapid degradation. cI joins the  regulator cI (BBa_R0051)</p>
+<p>Region coding for the repressor cI, of lambda phage, tagged with an LVA tail for rapid degradation. cI joins the  regulator cI (BBa_R0051)</p>
-<p>(Previous experience: none)</p>
+<p>(Previous experience: none)</p><br>
-<p><strong><em>Part:BBa_R0051</em></strong></p>
+<p><li><strong><em>Part:BBa_R0051</em></strong></li></p>
 <p><div id="dmii"><img src="http://docs.google.com/File?id=dc5zwbn5_7fsbr26rq_b" alt="" width="580" id="zrt-" /></div>
-<p align="center">&nbsp;<br />
+<p align="center">&nbsp;
 </p>
-<p>Promoter regulated by cI based on the pR promoter of lambda phage. The  promoter has two binding sites to cI repressor of lambda phage  (BBa_C0051). The union of cI results in the suppression of the  transcript. </p>
+<p>Promoter regulated by cI based on the pR promoter of lambda phage. The  promoter has two binding sites for the cI repressor of lambda phage  (BBa_C0051). The binding of cI leads to the suppression of the transcript synthesis. </p>
 <p>(Previous experience: it works) <br />
    <br />
-   Of the previous 3  bioparts, the sequence is in the registration of biological  parts and according to this page, DNA is available. </p>
+   The sequence of the 3 previously mentioned bioparts is in the <a href = http://partsregistry.org/Main_Page> Registry of Standard Biological Parts </a> and according to the information provided by the registry, DNA is available. </p><br>
-<p><strong><em>  Part: BBa_G00510</em></strong></p>
+<p><strong><em> <li> Part: BBa_G00510 </li></em></strong></p>
-<p> This is the forward primer of C0051 that has 24 pb. <br />
+gatttctgcatagccagacttggg<br>
-  (No DNA in the bank, but we know that it works) <br />
+<p> This is the forward primer for C0051, 24 bp long. <br /></p><br>
-  gatttctgcatagccagacttggg </p>
+<p><strong><em>  <li>Part: BBa_G00511 </li></em></strong></p>
-<p><strong><em>  Part: BBa_G00511 </em></strong></p>
+cactgactagcgataactttccccac<br>
-<p>  Reverse primer for C0051 that has 26 pb. <br />
+<p>  Reverse primer for C0051, 26 bp long. <br /></p><br>
-  cactgactagcgataactttccccac <br />
-  (No DNA in the bank but we know that it works)</p>
 <p><strong>Vectors</strong></p>
-<p>We need to define the vectors we can use. </p>
+<p>  Possibilities in bioparts: <br />
-<p>  Possibilities: <br />
-  *The ones recorded in the spreadsheet (courses). <br />
-  <br />
-  In bioparts:</p>
 <table width="500" border="2">
    <tr>
@@ Line 216: / Line 209: @@
      <td>pCK01BB1</td>
    </tr>
-</table>
+</table><br>
 <p><strong>Primers</strong></p>
 <p>  Build or find oligos that we could use for our constructions.</p>
 <p>  We need: <br />
    • rcnA (with its regulatory region; no promoter).<br />
-   • cI *.<br />
+   • cI* with its AHL-LuxR dependent promoter.<br />
-   • Constitutive promoter for luxR (tetR is proposed, it is a strong promoter). <br />
+   • LuxR with its constitutive tetR promoter. <br />
-   • Constitutive promoter for aiiA (lacZ is proposed, it is a moderate promoter). <br />
+   • AiiA with its constitutive promoter (lac is proposed, it is a moderate promoter).<br />
-  • aiiA.<br />
    • Promoter dependent of cI.<br />
-   ~ In all cases, we have to check whether they already exist (in biopartes or something) and evaluate them.</p>
+   <span class="font-size: small">&nbsp;In all cases, we have to check whether they already exist (in bioparts or elsewhere) and evaluate them. </span></p>
 <table border="2" cellspacing="0" cellpadding="0" width="500">
    <tr>
@@ Line 234: / Line 226: @@
      <td width="94" valign="bottom"><p align="center"><strong>Tm</strong></p></td>
      <td width="35" valign="bottom"><p align="center"><strong>Deg.</strong></p></td>
-     <td width="67" valign="bottom"><p align="center"><strong>Restr. S</strong></p></td>
+     <td width="67" valign="bottom"><p align="center"><strong>Restr. Site</strong></p></td>
      <td width="100" valign="bottom"><p align="center"><strong>Bioparts</strong></p></td>
    </tr>
    <tr>
-     <td width="107" valign="bottom"><div>
+     <td width="107" rowspan="2 valign="bottom"><div>
-       <p align="center">(pTetR)luxR/(p. </p>
+       <p align="center">(pTetR)luxR/(p.c.strong)aiiA </p>
      </div></td>
      <td width="56" valign="bottom"><div>
@@ Line 261: / Line 253: @@
    </tr>
    <tr>
-    <td width="107" valign="bottom"><div>
-      <p align="center">c.fuerte)aiiA </p>
-    </div></td>
      <td width="56" valign="bottom"><div>
        <p align="center">Lower </p>
@@ Line 444: / Line 433: @@
    </tr>
 </table>
+<br>
 <p><strong>Promoters</strong></p>
-<p>Investigate a little more about the proposed promoters and define whether they are the most optimal.</p>
+<p>Investigate more about the proposed promoters and define if they are the most optimal depending on our needs.</p>
 <table border="2" cellspacing="0" cellpadding="0" width="580">
    <tr>
@@ Line 615: / Line 605: @@
    </tr>
 </table>
+<br>
 <p><strong>Facts about  kinetics &amp; other things...</strong></p>
 <p>
-   Investigate a little  more about the parties involved in the system to begin with an outline  of modeling and defining how the design is theoretically feasible. <br />
+   Investigate more about the elements of the system to begin building an outline for the model and defining if design is theoretically feasible. <br />
    <br />
-   <em>Note: </em>To join HSLwith  LuxR and enable the transcription of cI, HLS should be at a concentration of micromolar order.<br />
+   NOTES: For LuxR to bind HSL and enable the transcription of cI, HLS should be at a micromolar concentration.<br />
-   <em>Note (2)</em>: Not all bioparts have been used previously, most DNA is  available but still there is no record of it working. We need to check  the quality of DNA to ensure that there will be no problems.</p>
+   Not all bioparts have been previously used, most DNA is  available but there is still no record their functionality. We need to evaluate the DNA quality to ensure that there will be no problems.</p>
         </tr>
 <tr>
@@ Line 626: / Line 617: @@
          </tr>
          <tr>
-<td class="bodyText"><p align="center"><strong>Modeling</strong><br>
+<td class="bodyText"><p><strong>Modeling</strong><br>
    <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br>
      Concentrations of:</p>
-<ul>
    <li>LuxR  (constant). </li>
    <li>aiiA  (constant). </li>
@@ Line 635: / Line 625: @@
    <li>cI* (according to aiiA, AHL &amp; LuxR). </li>
    <li>RcnA (according to cI*). </li>
-</ul>
+<p>We need to determine the initial concentrations and lifetime of proteins involved, as well as the efficiency of AiiA (kinetics in general). <br />
-<p>Knowing the initial concentrations and lifetime of proteins involved, as well as the efficiency action of aiiA (kinetics in general). <br />
+The concentration of Nickel (NiCl2) in the medium that the cells can tolerate according to Rodrigue et al. (2005) before inhibiting growth is 4 μ M for the strain lacking rcnA, 10 μM in the wildtype and up to 100-fold more in a strain with a multicopy gene.</p><br />
-* The concentration of Nickel (NiCl2) in the medium which supports the  cell according to Rodrigue et al. (2005) before inhibiting growth is 4 μ M for the  strain lacking rcnA, 10 μ M in the wildtype and up to 100 times more in  a strain with a multicopy gene.</p><br /><br /><br />
 <p>&nbsp;</p>
 <table border="0" cellspacing="0" cellpadding="0">
@@ Line 687: / Line 676: @@
    </tr>
 </table>
-<p><em>Assumption 1:</em> Once there is nickel in the medium, RcnR does not matter  for the pump regulation. This because there will be  large concentrations of metal,  so we can assume that RcnR will always be linked to a molecule and it  will therefore be unable to suppress the transcript of rcnA; the noise that   the few RcnR free molecules can cause,  will be  indistinguishable from normal behaviour of the pump. <br />
+<p><em>Assumption 1:</em> Once there is nickel in the medium, RcnR will not interfere in the pump regulation. This because there will be large concentrations of metal, so we can assume that RcnR will always be bound to a molecule of nickel and it will therefore be unable to suppress the transcription of rcnA; the noise that the few RcnR free molecules can cause, will be indistinguishable from normal behaviour of the pump. <br />
 </p>
-<p><em>Assumption  2:</em> Any decrease in the concentration of AHL is due to aiiA. It is  believed that the natural degradation of this is irrelevant in the time  scale analysis. Either way, a process will not be distinguishable from  the other and even when the first is estimated, it would not be very  informative for the analysis, so we intend to  take this assumption as  true. <br />
+<p><em>Assumption  2:</em> Any decrease in the concentration of AHL is due to aiiA. It is  believed that the natural degradation of this molecule is irrelevant in the time  scale analysis. Either way, a process will not be distinguishable from  the other and even when the first is estimated, it would not be very  informative for the analysis, so we intend to  take this assumption as  true. <br />
    </p>
-<p><em>Assumption 3:</em> The transcription of cI * depends solely on the  concentration of AHL. LuxR is not a limiting step, ie, it is in  constant concentration and in sufficient quantity to be always  available to associate with AHL. Only to simplify the analysis, at  least as a first approximation.</p>
+<p><em>Assumption 3:</em> The transcription of cI* depends solely on the concentration of AHL. LuxR is not a limiting step, ie, it is in a constant concentration and in sufficient amount to always be ready to associate with AHL. Only to simplify the analysis, at least for our first approach.</p>
 <p><strong>Initial outline:</strong></p>
 <p>(v1) AHL0 <br />
@@ Line 707: / Line 696: @@
          </tr>
          <tr>
-<td class="bodyText"><p><p><strong>Experimental work</strong></p>
+<td class="bodyText"><p><p><strong>Wet Lab/strong></p>
 <p>&nbsp;</p>
 <p>1. Take the sequences (fasta format) <br />