User contributions
From 2008.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 20:30, 20 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 19/Purple Russian Colony 5 Vf (New page: LLC) (top)
- 20:29, 20 June 2008 (diff | hist) N File:June19 colony 5 pf.jpg (top)
- 20:28, 20 June 2008 (diff | hist) N File:June19 colony 5 vf.jpg (top)
- 20:24, 20 June 2008 (diff | hist) Team:The University of Alberta/Sequencing
- 20:14, 20 June 2008 (diff | hist) Team:The University of Alberta/Project
- 20:13, 20 June 2008 (diff | hist) Team:The University of Alberta/Project (→Sequencing Results)
- 20:13, 20 June 2008 (diff | hist) Team:The University of Alberta/Project (→Journals)
- 17:48, 20 June 2008 (diff | hist) Team:The University of Alberta (→Special Thanks)
- 17:43, 20 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:41, 20 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today)
- 17:37, 20 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today)
- 17:26, 20 June 2008 (diff | hist) N Team:The University of Alberta/20 June 2008 (New page: ==Today== *Got the sequencing results back from the "Purple Russian Colony #5" sequencing that Winnie did. Looks like it didn't work at all (see the [[Team:The_University_of_Alberta/Sequen...)
- 17:50, 19 June 2008 (diff | hist) N Team:The University of Alberta/19 June 2008 (New page: ==Today== '''Chris''' *More work on the Westerns *Did a miniprep of the TetR biobrick from the iGEM Parts binder. Concentration = 146.0ng/ul. Placed in "Miniprep 2" box.)
- 17:46, 18 June 2008 (diff | hist) N File:Blue ox june17edit.jpg (top)
- 17:46, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Blue Ox (New page: ACCCNNNNATGNAAGNNGAANANGGCCNCATNTGAAGCGGCCNCATCTNCCAGTCTTCGTCGACAAANCCNTNGAGGTCT GTTCTTGTTGCCGCTGCCCAAGAGTTGTTANTCCAACCTAAGAATAGAATTATACCATTTTCAGCGGGAGCTAATTTACT AGAAGTTCTCAGAGAGAACGGTGTTG...) (top)
- 17:46, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:38, 18 June 2008 (diff | hist) N File:Tryp june17edit.jpg (top)
- 17:38, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Tryp (New page: TNNNNNGNNNTGNNATNNTGNANATTGNATCCTCGGCACNTTCACNCTCGCNTACTTTCTTCCGTCTTCGTCGACAAAGC CAACGNTNGATCNTGTTCTTGTTGCCGCTGCCCAAAAGGATTACGTCATGGAGAACTTCAAGCATCTGCCAGAGCCATTT AGAATAAGAGTCATCGAGCCTGTTAA...) (top)
- 17:37, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:28, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:27, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:27, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:26, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:25, 18 June 2008 (diff | hist) N File:Purple russian june17edit.jpg (top)
- 17:25, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Purple Russian (New page: AGAGACTATGCCATTTAAGACAACCATCGAGGGAACGGTAAACGGGCATTNCNTTCAAGTGTACTGGTAAGGGAGAGGGT AATCCATTTGAAGGCNCACAGGAGATGAAGATAGAGGTTATTGAAGGAGGACCTCTTCCTTTCGCTTTCCACATTTTGTC TACCTCATGCATGTACGGCTCCAAGA...) (top)
- 17:24, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:24, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing/June 17 (Removing all content from page) (top)
- 17:23, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17 (New page: AGAGACTATGCCATTTAAGACAACCATCGAGGGAACGGTAAACGGGCATTNCNTTCAAGTGTACTGGTAAGGGAGAGGGT AATCCATTTGAAGGCNCACAGGAGATGAAGATAGAGGTTATTGAAGGAGGACCTCTTCCTTTCGCTTTCCACATTTTGTC TACCTCATGCATGTACGGCTCCAAGA...)
- 17:22, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing (New page: ==June 17== Purple Russian in J61003 from Transformed Colonies: Sequence | Chromatogram)
- 17:16, 18 June 2008 (diff | hist) N Team:The University of Alberta/18 June 2008 (New page: '''Today''' *Got the sequences back that Jason did yesterday. They look good (aligned to the reference sequences, and they matched). The sequences have been added to a [[Team:The_Universit...)
- 20:37, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→Troubleshooting Results)
- 19:42, 17 June 2008 (diff | hist) N File:June17 puc57 genes.jpg (top)
- 19:42, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→Troubleshooting Results)
- 17:38, 17 June 2008 (diff | hist) N Team:The University of Alberta/17 June 2008 (New page: ==Today== Today we are continuing the troubleshooting from yesterday. ==Troubleshooting Results== '''Saima'''<br> Tried doing digests from ...)
- 16:10, 17 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results) (top)
- 22:43, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results)
- 22:41, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results)
- 22:41, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008
- 17:39, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008
- 17:21, 16 June 2008 (diff | hist) N Team:The University of Alberta/16 June 2008 (New page: ==Troubleshooting Day== We have been getting alot of bad results (or no results at all) in the lab lately - our gel purifications have had very low yields, the Westerns have no been workin...)
- 19:53, 13 June 2008 (diff | hist) Team:The University of Alberta/13 June 2008 (→Today) (top)
- 17:47, 13 June 2008 (diff | hist) Team:The University of Alberta/13 June 2008
- 17:41, 13 June 2008 (diff | hist) N Team:The University of Alberta/13 June 2008 (New page: ==Today== *Developed the Westerns after an overnight exposure. Blank yet again. James thought the problem was due to the development solution used - it was an old tube in the fridge that h...)
- 17:35, 13 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today) (top)
- 16:32, 13 June 2008 (diff | hist) N File:June12 colony pcr.jpg (top)
- 16:29, 13 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 19:45, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 19:44, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 17:17, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008
- 19:46, 11 June 2008 (diff | hist) Team:The University of Alberta/11 June 2008 (→To Do) (top)
- 16:39, 11 June 2008 (diff | hist) N Team:The University of Alberta/11 June 2008 (New page: ==Today== *The Ni-NTA columns have finally arrived! *Got the results back from Winnie's sequencing of the BlueOx BioBrick; they didn't look good. She is going to redo the sequencing (colon...)
- 20:30, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 20:29, 10 June 2008 (diff | hist) m Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 20:29, 10 June 2008 (diff | hist) N File:25 35 thio crude soluable edit.jpg (top)
- 20:28, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 17:30, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008
- 17:00, 10 June 2008 (diff | hist) N Team:The University of Alberta/10 June 2008 (New page: ==The Day of Strange Results== *The Purple Russian transformants did not grow yet again. This time it might be because Jason made a mistake while transforming the competent cells. We shoul...)
- 21:53, 9 June 2008 (diff | hist) Team:The University of Alberta/9 June 2008 (top)
- 18:12, 9 June 2008 (diff | hist) N File:Project diagram.jpg (top)
- 18:11, 9 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→The Project)
- 18:11, 9 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 17:01, 9 June 2008 (diff | hist) N Team:The University of Alberta/9 June 2008 (New page: '''To Do''': *check to see if Ni-Columns have arrived *Finish westerns '''Today''':<br> *Checked the transformants Anthony did on the weekend. The Purple Russian had no growth at all :( T...)
- 22:56, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→To Do) (top)
- 22:54, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→To Do)
- 22:46, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 19:56, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 17:12, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 17:09, 6 June 2008 (diff | hist) N Team:The University of Alberta/6 June 2008 (New page: ==Today== *We got the new reverse primers for Purple Russian and Tryp in today. We set up PCR using these reverse primers with the forward primers for Purple Russian and Tryp that we got l...)
- 21:28, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 21:26, 5 June 2008 (diff | hist) Team:The University of Alberta/Project (→Estrogen Receptors)
- 21:10, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick) (top)
- 21:03, 5 June 2008 (diff | hist) N Team:The University of Alberta/Butanerd (New page: '''The Butanerd project from last year is still alive and kicking! Here is where we will put all the info on the work we've done this year on our butanol biofuel.''')
- 21:02, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 21:01, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 20:59, 5 June 2008 (diff | hist) N File:Butanerd button.jpg (top)
- 20:54, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick)
- 20:28, 5 June 2008 (diff | hist) N File:Blue ox confirm.jpg (top)
- 20:28, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick)
- 20:27, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008
- 16:22, 5 June 2008 (diff | hist) N Team:The University of Alberta/5 June 2008 (New page: ==To Do Today== *confirm Blue Ox Biobrick *plant plants *water plants in the growth chamber *colony PCR for all of the butanol biobricks in both J61003 and I0500 *read lots of papers! *fin...)
- 22:58, 4 June 2008 (diff | hist) Team:The University of Alberta/4 June 2008 (top)
- 22:53, 4 June 2008 (diff | hist) Team:The University of Alberta/4 June 2008
- 16:28, 4 June 2008 (diff | hist) N Team:The University of Alberta/4 June 2008 (New page: '''Continued From Yesterday...'''<br> Anthony did a miniprep of our putative Blue Ox + suffix/prefix yesterday evening; David then did a digest of this with EcoRI and PstI to determine if ...)
- 22:01, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Other Info)
- 21:58, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Plant Info)
- 21:58, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 21:56, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Estrogen Receptors)
- 21:55, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 21:54, 3 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 21:51, 3 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 21:46, 3 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 21:09, 3 June 2008 (diff | hist) Wen Winnie Xu (top)
- 21:09, 3 June 2008 (diff | hist) Wen Winnie Xu
- 21:05, 3 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:53, 3 June 2008 (diff | hist) Team:The University of Alberta/3 June 2008
- 17:02, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 17:00, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 16:25, 3 June 2008 (diff | hist) N Team:The University of Alberta/3 June 2008 (New page: '''Continued from yesterday...'''<br> Yesterday, Jason made transformants using our working Blue Ox (used the primers, ligated the product into vector and transformed competent cells). The...)
- 23:22, 2 June 2008 (diff | hist) Team:The University of Alberta/2 June 2008 (top)
- 19:55, 2 June 2008 (diff | hist) Team:The University of Alberta/2 June 2008 (→Tip of the Day)
- 19:54, 2 June 2008 (diff | hist) Team:The University of Alberta/2 June 2008 (→Bad News)
- 19:51, 2 June 2008 (diff | hist) Team:The University of Alberta/2 June 2008 (→Bad News)
- 19:47, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:47, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:46, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:41, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:40, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 19:36, 2 June 2008 (diff | hist) File:Plasticbutton.jpg (uploaded a new version of "Image:Plasticbutton.jpg") (top)
- 19:35, 2 June 2008 (diff | hist) N File:Plasticbutton.jpg
- 19:34, 2 June 2008 (diff | hist) N File:Plantbutton.jpg (top)
- 17:31, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 17:06, 2 June 2008 (diff | hist) Team:The University of Alberta/Project
- 16:44, 2 June 2008 (diff | hist) Team:The University of Alberta/Project (→Journals)
- 16:03, 30 May 2008 (diff | hist) Team:The University of Alberta/30 May 2008 (→A bit of an Anomaly)
- 15:57, 30 May 2008 (diff | hist) N File:Fsm gel.jpg (top)
- 15:55, 30 May 2008 (diff | hist) Team:The University of Alberta/30 May 2008
- 15:54, 30 May 2008 (diff | hist) Team:The University of Alberta/30 May 2008
- 21:35, 29 May 2008 (diff | hist) Team:The University of Alberta/30 May 2008 (Removing all content from page)
- 18:49, 29 May 2008 (diff | hist) Team:The University of Alberta/29 May 2008 (→On this Episode of "What we Did in the Lab Today") (top)
- 17:20, 29 May 2008 (diff | hist) Team:The University of Alberta/29 May 2008 (→Volunteers Scheduled for Today)
- 17:11, 29 May 2008 (diff | hist) Team:The University of Alberta/28 May 2008 (→What We did Today) (top)
- 16:14, 29 May 2008 (diff | hist) Team:The University of Alberta/28 May 2008 (→Lab Tip of The Day)
- 20:42, 28 May 2008 (diff | hist) Team:University of Alberta
- 20:41, 28 May 2008 (diff | hist) Team:University of Alberta
- 20:38, 28 May 2008 (diff | hist) File:Uofa main botton.jpg (uploaded a new version of "Image:Uofa main botton.jpg") (top)
- 20:36, 28 May 2008 (diff | hist) Team:University of Alberta
- 20:28, 28 May 2008 (diff | hist) N File:Uofa main botton.jpg
- 20:27, 28 May 2008 (diff | hist) Team:University of Alberta
- 19:58, 28 May 2008 (diff | hist) N File:Uofa main.jpg (top)
- 19:58, 28 May 2008 (diff | hist) Team:University of Alberta
- 17:11, 28 May 2008 (diff | hist) Team:University of Alberta
- 22:51, 27 May 2008 (diff | hist) Team:The University of Alberta/27 May 2008 (top)
- 16:26, 27 May 2008 (diff | hist) Team:The University of Alberta/26 May 2008 (→Today In The Lab) (top)
- 05:40, 27 May 2008 (diff | hist) User:Cwk (top)
- 19:37, 26 May 2008 (diff | hist) Team:The University of Alberta/26 May 2008 (→Today In The Lab)
- 18:59, 26 May 2008 (diff | hist) Team:The University of Alberta/26 May 2008 (→Today In The Lab)
- 18:08, 26 May 2008 (diff | hist) Team:The University of Alberta/26 May 2008 (→Today In The Lab)
- 16:45, 26 May 2008 (diff | hist) Team:The University of Alberta/26 May 2008
- 22:45, 23 May 2008 (diff | hist) Team:University of Alberta
- 22:42, 23 May 2008 (diff | hist) N File:Igem canada.jpg (top)
- 22:32, 23 May 2008 (diff | hist) Team:The University of Alberta/21 May 2008 (top)
- 22:31, 23 May 2008 (diff | hist) Team:The University of Alberta/22 May 2008 (→Stuff we did Today) (top)
- 22:27, 23 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 22:26, 23 May 2008 (diff | hist) N File:Winnie.jpg (top)
- 22:26, 23 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 22:17, 23 May 2008 (diff | hist) Team:The University of Alberta/22 May 2008 (→Stuff we did Today)
- 22:10, 23 May 2008 (diff | hist) Team:The University of Alberta/23 May 2008 (→What we accomplished today)
- 22:09, 23 May 2008 (diff | hist) Team:The University of Alberta/23 May 2008
- 21:00, 23 May 2008 (diff | hist) Team:The University of Alberta/Project
- 20:44, 23 May 2008 (diff | hist) Team:The University of Alberta/23 May 2008 (→The legacy of the Purple Russian and the Blue Ox)
- 19:34, 23 May 2008 (diff | hist) Team:The University of Alberta/23 May 2008
- 20:57, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 6) (top)
- 20:56, 22 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (top)
- 20:56, 22 May 2008 (diff | hist) Team:The University of Alberta/20 May 2008 (top)
- 20:55, 22 May 2008 (diff | hist) Team:The University of Alberta/21 May 2008
- 20:55, 22 May 2008 (diff | hist) Team:The University of Alberta/21 May 2008
- 20:55, 22 May 2008 (diff | hist) Team:The University of Alberta/20 May 2008
- 20:54, 22 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008
- 20:52, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 6)
- 20:50, 22 May 2008 (diff | hist) N File:Opt6.jpg (top)
- 20:50, 22 May 2008 (diff | hist) N File:Opt5.jpg (top)
- 20:45, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 5)
- 20:34, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 4)
- 20:33, 22 May 2008 (diff | hist) N File:Opt4.jpg (top)
- 20:33, 22 May 2008 (diff | hist) N File:Opt3.jpg (top)
- 20:33, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 4)
- 20:30, 22 May 2008 (diff | hist) N User talk:Meagan (New page: No problem! If there's anything else I can help with, let me know :) ~~~~) (top)
- 20:27, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 4)
- 20:16, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 3)
- 19:49, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 2)
- 19:49, 22 May 2008 (diff | hist) N File:Opt2.jpg (top)
- 19:49, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 2)
- 19:48, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 2)
- 19:48, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 2)
- 19:42, 22 May 2008 (diff | hist) Talk:Team:University of Ottawa
- 19:42, 22 May 2008 (diff | hist) N Talk:Team:University of Ottawa (New page: '''Hey Ottawa''' '''Just University of Alberta here we just noticed that everything that we put on our calander shows up on yours???? Any Idea on how to fix that. EDIT: Fixed our calander;...)
- 19:42, 22 May 2008 (diff | hist) Team:University of Ottawa
- 19:30, 22 May 2008 (diff | hist) Team:The University of Alberta/22 May 2008 (→Chris)
- 19:24, 22 May 2008 (diff | hist) Team:The University of Alberta/Notebook
- 19:23, 22 May 2008 (diff | hist) Team:The University of Alberta/28 May 2008 (Removing all content from page)
- 19:23, 22 May 2008 (diff | hist) 23 May 2008 (Removing all content from page) (top)
- 19:23, 22 May 2008 (diff | hist) N Team:The University of Alberta/23 May 2008 (New page: ==Volunteers Scheduled for Today== 5-8 AL<br> 5-8 KR)
- 19:20, 22 May 2008 (diff | hist) 22 May 2008 (Removing all content from page) (top)
- 19:20, 22 May 2008 (diff | hist) N Team:The University of Alberta/22 May 2008 (New page: '''Volunteers Scheduled for Today''' 10-3 BH<br> 5-9 KR<br> 6-9 DL<br> ===Things to do:<br>=== Finish processing sequence reactions of 021,022,023,025,099<br> Transform ligation reaction...)
- 19:20, 22 May 2008 (diff | hist) 21 May 2008 (Removing all content from page) (top)
- 19:19, 22 May 2008 (diff | hist) N Team:The University of Alberta/21 May 2008 (New page: '''Volunteers Scheduled for Today''' 5-8 AS<br> 6-8 DL<br> '''Things to do''':<br> <strike>Mini-preps of O/N's</strike><br> Sequence gel purified fragments from yesterday<br> Transform I...)
- 19:18, 22 May 2008 (diff | hist) 20 May 2008 (Removing all content from page) (top)
- 19:18, 22 May 2008 (diff | hist) N Team:The University of Alberta/20 May 2008 (New page: ==To Do== Today we are researching PIF3 degredation as it might occur in Ecoli Writing the new fundraising letters Finishing construction of our biobricks Colony PCR,Gel extraction, a...)
- 19:16, 22 May 2008 (diff | hist) Team:The University of Alberta/Notebook
- 19:12, 22 May 2008 (diff | hist) User:Cwk
- 18:03, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 1)
- 17:56, 22 May 2008 (diff | hist) N File:Opt1.jpg (top)
- 17:54, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial (→Step 1)
- 17:45, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial
- 17:44, 22 May 2008 (diff | hist) Team:The University of Alberta/Optimization Tutorial
- 17:24, 22 May 2008 (diff | hist) 22 May 2008 (→Chris)
- 17:23, 22 May 2008 (diff | hist) N Team:The University Of Alberta/Optimization Tutorial (Team:The University Of Alberta/Optimization Tutorial moved to Team:The University of Alberta/Optimization Tutorial) (top)
- 17:23, 22 May 2008 (diff | hist) m Team:The University of Alberta/Optimization Tutorial (Team:The University Of Alberta/Optimization Tutorial moved to Team:The University of Alberta/Optimization Tutorial)
- 17:22, 22 May 2008 (diff | hist) N Team:The University of Alberta/Optimization Tutorial (New page: '''UNDER CONSTRUCTION''')
- 17:21, 22 May 2008 (diff | hist) 22 May 2008 (→Things to do:)
- 17:17, 22 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 16:52, 22 May 2008 (diff | hist) N Team:The University of Alberta/28 May 2008 (New page: test)
- 16:04, 22 May 2008 (diff | hist) 22 May 2008 (→Volunteers Scheduled for Today)
- 15:58, 22 May 2008 (diff | hist) 21 May 2008
- 23:57, 21 May 2008 (diff | hist) 21 May 2008
- 23:03, 21 May 2008 (diff | hist) 21 May 2008 (→Volunteers Scheduled for Today)
- 22:50, 21 May 2008 (diff | hist) 21 May 2008 (→Volunteers Scheduled for Today)
- 22:29, 21 May 2008 (diff | hist) 21 May 2008
- 22:10, 21 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 22:04, 21 May 2008 (diff | hist) N User:Cwk (New page: Chris Kelly is a recent graduate of the University of Alberta's molecular genetics program and a first time participant in iGEM. His interests include (but are not limited to) science, sci...)
- 20:48, 21 May 2008 (diff | hist) 20 May 2008 (→What Got Done)
- 20:42, 21 May 2008 (diff | hist) 14 July 2008 (Removing all content from page) (top)
- 19:40, 21 May 2008 (diff | hist) N Team:The University Of Alberta/14 July 2008 (Team:The University Of Alberta/14 July 2008 moved to 14 July 2008 over redirect) (top)
- 19:40, 21 May 2008 (diff | hist) m 14 July 2008 (Team:The University Of Alberta/14 July 2008 moved to 14 July 2008 over redirect)
- 19:39, 21 May 2008 (diff | hist) m 14 July 2008 (14 July 2008 moved to Team:The University Of Alberta/14 July 2008)
- 19:37, 21 May 2008 (diff | hist) N 14 July 2008 (New page: test)
- 22:08, 20 May 2008 (diff | hist) N File:Chris.jpg (top)
- 22:08, 20 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 22:08, 20 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 21:47, 20 May 2008 (diff | hist) 20 May 2008 (→To Do)
- 21:41, 20 May 2008 (diff | hist) Team:The University of Alberta/Notebook
- 21:38, 20 May 2008 (diff | hist) Team:The University of Alberta/Project
- 21:38, 20 May 2008 (diff | hist) Team:The University of Alberta/Team
- 21:37, 20 May 2008 (diff | hist) Team:The University of Alberta
- 21:36, 20 May 2008 (diff | hist) Team:The University of Alberta
- 21:35, 20 May 2008 (diff | hist) Team:University of Alberta
- 21:33, 20 May 2008 (diff | hist) Team:University of Alberta
- 21:30, 20 May 2008 (diff | hist) Team:University of Alberta
- 21:20, 20 May 2008 (diff | hist) File:Team.png (Removing all content from page)
- 21:17, 20 May 2008 (diff | hist) File:Team.png (Redirecting to Team:The University of Alberta/Team)
- 21:14, 20 May 2008 (diff | hist) File:Team.png (Redirecting to Team:University of Alberta/Team)
- 21:13, 20 May 2008 (diff | hist) File:Team.png (Redirecting to Team:University of Alberta/Team)
- 21:12, 20 May 2008 (diff | hist) File:Team.png (Redirecting to Team:The University of Alberta/Team)
- 20:53, 20 May 2008 (diff | hist) 20 May 2008 (→To Do)
- 20:45, 20 May 2008 (diff | hist) Team:University of Alberta
- 20:26, 20 May 2008 (diff | hist) 20 May 2008 (→Lab Tip of The Day)
- 20:22, 20 May 2008 (diff | hist) 20 May 2008 (→To Do)
- 20:22, 20 May 2008 (diff | hist) 20 May 2008 (→To Do)
- 20:03, 20 May 2008 (diff | hist) N File:Lolcat biobrick.jpg (top)
- 19:54, 20 May 2008 (diff | hist) 20 May 2008 (→To Do)
- 19:51, 20 May 2008 (diff | hist) N File:Phy operon.png (top)
- 15:28, 20 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 21:39, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 21:25, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 20:30, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 20:26, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 20:25, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 20:24, 16 May 2008 (diff | hist) N File:Examplediagram.png (top)
- 20:02, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
- 20:02, 16 May 2008 (diff | hist) Team:The University of Alberta/16 May 2008 (→In the Lab)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)