User contributions
From 2008.igem.org
- 21:51, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Bisphenol A)
- 21:51, 29 October 2008 (diff | hist) Team:University of Alberta/Plant Project (→Status of Project)
- 21:49, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 21:48, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Status)
- 21:45, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 21:44, 29 October 2008 (diff | hist) Team:The University of Alberta/Project
- 21:42, 29 October 2008 (diff | hist) Team:The University of Alberta/Parts
- 21:42, 29 October 2008 (diff | hist) Team:The University of Alberta/Notebook
- 21:42, 29 October 2008 (diff | hist) Team:The University of Alberta/Butanerd
- 21:41, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 21:36, 29 October 2008 (diff | hist) Team:University of Alberta/Plant Project
- 21:34, 29 October 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Status)
- 21:33, 29 October 2008 (diff | hist) Team:The University of Alberta/Project (→Sequencing Results)
- 21:33, 29 October 2008 (diff | hist) Team:The University of Alberta/Project (→Other documents)
- 21:32, 29 October 2008 (diff | hist) Team:The University of Alberta/Project (→Journals)
- 21:28, 29 October 2008 (diff | hist) Team:The University of Alberta (→Our Project: Bisphenol Eh?)
- 18:15, 29 October 2008 (diff | hist) Team:The University of Alberta (→Our Project: Bisphenol Eh!)
- 03:46, 29 October 2008 (diff | hist) Team:The University of Alberta/9 October 2008 (top)
- 03:44, 29 October 2008 (diff | hist) N Team:The University of Alberta/8 October 2008 (New page: ==David== i picked colonies from yesterdays pUC57-pTET-BisdA+pTET-BisdB transformation and grew them up in LB amp overnight.) (top)
- 03:43, 29 October 2008 (diff | hist) N Team:The University of Alberta/7 October 2008 (New page: ==David== i transformed competent cells with yesterday's pUC57-pTET-BisdA+pTET-BisdB ligation.) (top)
- 03:42, 29 October 2008 (diff | hist) N Team:The University of Alberta/6 October 2008 (New page: ==David== i digested pUC57 pTET-BisdA with SphI+PstI+CIP treatment pTET+BisdB with XbaI+PstI i gel purified the products and set up a ligation of pUC57-pTET-BisdA+pTET-BisdB overnight...) (top)
- 03:39, 29 October 2008 (diff | hist) Team:The University of Alberta/3 October 2008 (top)
- 03:37, 29 October 2008 (diff | hist) Team:The University of Alberta/2 October 2008 (top)
- 03:35, 29 October 2008 (diff | hist) Team:The University of Alberta/1 October 2008 (top)
- 03:34, 29 October 2008 (diff | hist) Team:The University of Alberta/30 September 2008 (top)
- 03:26, 29 October 2008 (diff | hist) N Team:The University of Alberta/10 October 2008 (New page: ==David== i am leaving for thanksgiving, which in canada happens at awesome-o'clock instead of november.) (top)
- 03:24, 29 October 2008 (diff | hist) Team:The University of Alberta/28 October 2008 (→David) (top)
- 03:23, 29 October 2008 (diff | hist) Team:The University of Alberta/26 October 2008 (→Jason) (top)
- 03:22, 29 October 2008 (diff | hist) Team:The University of Alberta/25 October 2008 (→David)
- 03:21, 29 October 2008 (diff | hist) Team:The University of Alberta/24 October 2008 (→David)
- 03:19, 29 October 2008 (diff | hist) Team:The University of Alberta/23 October 2008 (→David)
- 03:19, 29 October 2008 (diff | hist) Team:The University of Alberta/22 October 2008 (→David)
- 03:18, 29 October 2008 (diff | hist) Team:The University of Alberta/21 October 2008 (→David)
- 03:17, 29 October 2008 (diff | hist) Team:The University of Alberta/18 October 2008 (→David) (top)
- 03:17, 29 October 2008 (diff | hist) Team:The University of Alberta/17 October 2008 (→David) (top)
- 03:16, 29 October 2008 (diff | hist) Team:The University of Alberta/16 October 2008 (→David) (top)
- 03:16, 29 October 2008 (diff | hist) Team:The University of Alberta/20 October 2008 (top)
- 03:13, 29 October 2008 (diff | hist) N Team:The University of Alberta/19 October 2008 (New page: ==David== the successful colonies from yesterday were used to start overnight cultures in LB amp.) (top)
- 03:12, 29 October 2008 (diff | hist) N Team:The University of Alberta/18 October 2008 (New page: ==David== i pcr checked candidate colonies of the pSB103+BisdA transformation and found successful colonies.)
- 03:11, 29 October 2008 (diff | hist) N Team:The University of Alberta/17 October 2008 (New page: ==David== i transformed competent cells with the pSB103+bisdA ligation.)
- 03:10, 29 October 2008 (diff | hist) N Team:The University of Alberta/16 October 2008 (New page: ==David== back from my thanksgiving break and yes my nieces remain awesome, thanks for asking. i digested bisdA with Xbal+PstI, gel purified the product and set up a ligation with pSB1...)
- 03:07, 29 October 2008 (diff | hist) Team:The University of Alberta/20 October 2008
- 03:07, 29 October 2008 (diff | hist) N Team:The University of Alberta/20 October 2008 (New page: ==David== i mini-preppedi pUC57-pTET-BisdA pUC57-pTET-BisdB pUC57-laqIQ-ERE-TetR)
- 03:05, 29 October 2008 (diff | hist) Team:The University of Alberta/21 October 2008
- 03:05, 29 October 2008 (diff | hist) N Team:The University of Alberta/21 October 2008 (New page: i digested: pUC57-pTET-BisdA with SphI+PstI with CIP treatment pTET-BisdB with XbaI+PstI laqIQ-ERE-TetR with XbaI+PstI i set up the following ligations with the gel purified prod...)
- 03:02, 29 October 2008 (diff | hist) N Team:The University of Alberta/22 October 2008 (New page: ==David== i transformed the following ligations into competent cells: pUC57-pTET-BisdA+pTET-BisdB pSB103+laqIQ-ERE-TetR)
- 03:01, 29 October 2008 (diff | hist) N Team:The University of Alberta/23 October 2008 (New page: ==David== i performed mini-preps and NotI checking digests of the following transformational candidates: pUC57-pTET-BisdA-pTET-BisdB pSB103-laqIQ-ERE-TetR they both worked)
- 02:57, 29 October 2008 (diff | hist) Team:The University of Alberta/24 October 2008 (→David)
- 02:57, 29 October 2008 (diff | hist) N Team:The University of Alberta/24 October 2008 (New page: ==David== i digested laqIQ-ERE-TetR-pTET-RFP with XbaI+PstI, pTET-BisdA-pTET-BisdB with XbaI+PstI, pUC57-laqIQ-ERE-TetR-pTET-RFP with SphI+PstI and treated with CIP....)
- 02:53, 29 October 2008 (diff | hist) Team:The University of Alberta/26 October 2008 (→David)
- 02:53, 29 October 2008 (diff | hist) Team:The University of Alberta/26 October 2008 (→Jason)
- 02:53, 29 October 2008 (diff | hist) N Team:The University of Alberta/25 October 2008 (New page: ==David== today winnie and me poured some Kan plates. i transformed the ligations i had set up from yesterday (pSB103+laqIQ-ERE-TetR-pTET-RFP, pSB103+pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ER...)
- 02:51, 29 October 2008 (diff | hist) N Team:The University of Alberta/26 October 2008 (New page: ==Jason== I performed a mini-prep of pUC57-ER, subsequently digesting it with XbaI and PstI, gel purifying the fragment and using it one of the following ligations. I set up ligations fo...)
- 02:46, 29 October 2008 (diff | hist) N Team:The University of Alberta/27 October 2008 (New page: ==David== today i transformed ligations of pSB103+ER, pSB103+laqIQ-ERE-TetR-pTET-RFP, pSB103+pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ERE-TetR-pTET-RFP+pTET-BisdA-pTET-BisdB. i also started per...)
- 02:42, 29 October 2008 (diff | hist) N Team:The University of Alberta/28 October 2008 (New page: ==David== today i did a pcr check of candidate colonies for pSB103-ER, pSB103-laqIQ-ERE-TetR-pTET-RFP, pSB103-pTET-BisdA-pTET-BisdB, pUC57-laqIQ-ERE-TetR-pTET-RFP-pTET-BisdA-pTET-BisdB. ...)
- 01:38, 23 July 2008 (diff | hist) Team:The University of Alberta/22 July 2008 (top)
- 23:59, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→David's Crusade) (top)
- 23:51, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008
- 16:45, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:10, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:09, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:08, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Proposed Work Timeline: A Work In Progress)
- 16:07, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 16:06, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 16:06, 13 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→Info)
- 17:07, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (Removing all content from page)
- 17:06, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008
- 17:05, 12 June 2008 (diff | hist) N Team:The University of Alberta/12 June 2008 (New page: Prefix/suffix ''TetR Binding Site/Promoter'' '''GENE and HIS tag and Double Stop''' BisdA gaattcgcggccgcttctagag''tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac'''''atgcctcatatc...)
- 01:22, 11 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things) (top)
- 18:29, 2 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 18:29, 2 June 2008 (diff | hist) Team:The University of Alberta/Project (→Bisphenol A)
- 17:24, 30 May 2008 (diff | hist) David Lee Lancaster (top)
- 17:15, 30 May 2008 (diff | hist) David Lee Lancaster (→The Life and Times of David Lancaster)
- 16:41, 30 May 2008 (diff | hist) N David Lee Lancaster (New page: == The Life and Times of David Lancaster == David was born in Calgary, Alberta, Canada to some really awesome parents. Seriously. The best.)
- 15:14, 30 May 2008 (diff | hist) N File:Profile pic 1.jpg (top)
- 15:14, 30 May 2008 (diff | hist) Team:The University of Alberta/Team (→Students)