User contributions
From 2008.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 22:25, 29 October 2008 (diff | hist) Team:The University of Alberta (top)
- 22:08, 29 October 2008 (diff | hist) Team:University of Alberta/Plant Project
- 22:07, 29 October 2008 (diff | hist) Team:The University of Alberta/Notebook (top)
- 22:06, 29 October 2008 (diff | hist) Team:The University of Alberta/Project (top)
- 22:04, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 22:02, 29 October 2008 (diff | hist) N File:Justinp.jpg (top)
- 22:02, 29 October 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 22:01, 29 October 2008 (diff | hist) Team:The University of Alberta/Team (→Advisors)
- 22:01, 29 October 2008 (diff | hist) Team:The University of Alberta/Team (→Advisors)
- 22:01, 29 October 2008 (diff | hist) N File:Jamesmclagan.jpg (top)
- 22:00, 29 October 2008 (diff | hist) Team:The University of Alberta/Team (→Advisors)
- 21:57, 29 October 2008 (diff | hist) N File:Mikeellison.jpg (top)
- 21:55, 29 October 2008 (diff | hist) N File:Mikedeyholos.jpg (top)
- 21:55, 29 October 2008 (diff | hist) Team:The University of Alberta/Team (→Advisors)
- 21:49, 29 October 2008 (diff | hist) Team:The University of Alberta/Project
- 21:49, 29 October 2008 (diff | hist) Team:The University of Alberta (→Project 3: Butanerd)
- 21:43, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 21:42, 29 October 2008 (diff | hist) N File:Noimage.jpg (top)
- 21:41, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 21:18, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 21:08, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 20:58, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 20:56, 29 October 2008 (diff | hist) Team:The University of Alberta
- 20:51, 29 October 2008 (diff | hist) Team:The University of Alberta (→Special Thanks)
- 20:51, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:50, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:50, 29 October 2008 (diff | hist) Team:The University of Alberta (→Bronze Sponsors)
- 20:48, 29 October 2008 (diff | hist) Team:The University of Alberta (→Bronze Sponsors)
- 20:48, 29 October 2008 (diff | hist) Team:The University of Alberta (→Silver Sponsors)
- 20:47, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 20:47, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:47, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:46, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:46, 29 October 2008 (diff | hist) Team:The University of Alberta (→Our Project: Bisphenol Eh?)
- 20:46, 29 October 2008 (diff | hist) Team:The University of Alberta (→Our Project: Bisphenol Eh?)
- 20:46, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:46, 29 October 2008 (diff | hist) Team:The University of Alberta (→Contact)
- 20:45, 29 October 2008 (diff | hist) Team:The University of Alberta (→Our Project: Bisphenol Eh?)
- 20:43, 29 October 2008 (diff | hist) Team:The University of Alberta
- 20:24, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 20:23, 29 October 2008 (diff | hist) Team:The University of Alberta
- 20:05, 29 October 2008 (diff | hist) Team:The University of Alberta/Team
- 19:59, 29 October 2008 (diff | hist) Team:The University of Alberta
- 19:43, 29 October 2008 (diff | hist) Team:The University of Alberta (→Special Thanks)
- 19:42, 29 October 2008 (diff | hist) Team:The University of Alberta
- 19:41, 29 October 2008 (diff | hist) Team:The University of Alberta
- 18:40, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 18:40, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 18:40, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 18:39, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 18:39, 29 October 2008 (diff | hist) Team:The University of Alberta (→Gold sponsors)
- 18:22, 29 October 2008 (diff | hist) Team:The University of Alberta (→Silver Sponsors)
- 19:37, 28 August 2008 (diff | hist) N Team:The University of Alberta/28 August 2008 (New page: ==Today== *The Site Directed Mutagenesis appears to have worked. We will digest with NotI to find out for sure *ER01 + ER02 ligation transformants grew. Digesting and/or sequencing to make...) (top)
- 20:00, 27 August 2008 (diff | hist) Team:The University of Alberta/27 August 2008 (→Today) (top)
- 16:27, 27 August 2008 (diff | hist) N Team:The University of Alberta/27 August 2008 (New page: ==Today== *Finishing off the site-directed mutagenesis: digesting and transforming *The ER01 and ER02 digestions didnt work: got lots of bands. Will have to repeat. *TetR+RBS ligations did...)
- 17:47, 26 August 2008 (diff | hist) N Team:The University of Alberta/26 August 2008 (New page: ==Today== *The P0380+MCS transformants grew! Making overnights today. *The mutated PR grew as well. Overnights were set up. *Redoing the Site Directed Mutagenesis as follows: **5 reactions...) (top)
- 20:18, 25 August 2008 (diff | hist) Team:The University of Alberta/25 August 2008 (→Today) (top)
- 17:50, 25 August 2008 (diff | hist) N Team:The University of Alberta/25 August 2008 (New page: ==Today== *Transforming the P0380+MCS ligation (#7, #2 and #4 were done using bad P0380 samples) *Transforming mutated Purple Russian into "Blue" cells.)
- 20:14, 22 August 2008 (diff | hist) Team:The University of Alberta/22 August 2008 (top)
- 16:25, 22 August 2008 (diff | hist) N Team:The University of Alberta/22 August 2008 (New page: ==Today== *ER01+ER02 didnt grow again. Dunno why not *Began to insert MCS into binary vector)
- 16:28, 21 August 2008 (diff | hist) N Team:The University of Alberta/21 August 2008 (New page: ==Today== *TetR+RBS transformations didnt work. We did digests of them yesterday just in case so we can transform + ligate them today *Doing transformation of ER01+ER02 *Purple Russian in ...) (top)
- 20:25, 20 August 2008 (diff | hist) m Team:The University of Alberta/20 August 2008 (→Today) (top)
- 16:47, 20 August 2008 (diff | hist) N Team:The University of Alberta/20 August 2008 (New page: ==Today== *The retransformed Site Directed Mutagenesis: Lots o' growth on the transformation control = good! Growth on the Mutagenesis control = good! Growth on the binary vector = very go...)
- 20:28, 19 August 2008 (diff | hist) N Team:The University of Alberta/19 August 2008 (New page: ==Today== *Regarding the Site Directed Mutagenesis: The transformed non-mutated binary vector did grow so we know that it is not too large to transform. *We do think we know the problem: t...) (top)
- 21:54, 18 August 2008 (diff | hist) Team:The University of Alberta/18 August 2008 (→Today) (top)
- 16:14, 18 August 2008 (diff | hist) N Team:The University of Alberta/18 August 2008 (New page: ==Today== *Site Directed Mutagenesis: Got LOTS of growth on the transformation control, a fair amount of growth on the mutagenesis control that was positive so we know that it works! HOWEV...)
- 17:17, 15 August 2008 (diff | hist) N Team:The University of Alberta/15 August 2008 (New page: ==Today== '''Chris''' *The transformations of the mutated binary vector did not grow: neither did the transformation control. Its likely that the transformation simply didnt work. *I am re...)
- 17:12, 15 August 2008 (diff | hist) N Team:The University of Alberta/14 August 2008 (New page: ==Today== '''Chris''' *Finshed off the Site Directed Mutagenesis of our binary vector - David and Kelly transformed the cells in the evening *Made fresh NZY+ broth) (top)
- 21:11, 13 August 2008 (diff | hist) Team:The University of Alberta/13 August 2008 (top)
- 16:51, 12 August 2008 (diff | hist) N File:Bioalberta.jpeg (top)
- 16:51, 12 August 2008 (diff | hist) Team:The University of Alberta
- 16:41, 12 August 2008 (diff | hist) N Team:The University of Alberta/12 August 2008 (New page: ==Today== '''Chris''' *Ligated Tryp into J6. Since the result of the ligase test from yesterday was inconclusive (because we didnt run any controls!) this may not work.)
- 16:39, 12 August 2008 (diff | hist) Team:The University of Alberta/11 August 2008 (→Today) (top)
- 16:21, 11 August 2008 (diff | hist) N Team:The University of Alberta/11 August 2008 (New page: ==Today== '''Chris''' *Got the sequence results back from Friday: Looks like the suspicious band was Tryp after all. Will go ahead with the ligation into Tryp. Ive decided that if it doesn...)
- 16:45, 8 August 2008 (diff | hist) N Team:The University of Alberta/8 August 2008 (New page: '''Chris''' *Ran the sequencing from yesterday (both mine and Jason's, plus one mystery sample that was in the box). Will have the results back tomorrow.)
- 16:43, 8 August 2008 (diff | hist) Team:The University of Alberta/7 August 2008
- 16:43, 8 August 2008 (diff | hist) Team:The University of Alberta/6 August 2008
- 16:42, 8 August 2008 (diff | hist) Team:The University of Alberta/5 August 2008 (→Back to the Lab after the Long Weekend!)
- 16:35, 8 August 2008 (diff | hist) Team:The University of Alberta/6 August 2008
- 16:28, 8 August 2008 (diff | hist) Team:The University of Alberta/5 August 2008 (→Back to the Lab after the Long Weekend!)
- 16:42, 5 August 2008 (diff | hist) N Team:The University of Alberta/5 August 2008 (New page: ==Back to the Lab after the Long Weekend!== '''Chris''' *Winnie redid the ligation of J6 and Tryp. I put transforming this on hold though because... **She also did colony PCR on some more ...)
- 15:19, 1 August 2008 (diff | hist) Team:The University of Alberta
- 16:46, 30 July 2008 (diff | hist) N Team:The University of Alberta/30 July 2008 (New page: ===Today=== '''Chris''' *Running the PCR from the lab water on a gel. Results pending. *Religated J6 and Tryp) (top)
- 16:44, 30 July 2008 (diff | hist) Team:The University of Alberta/29 July 2008 (→Today) (top)
- 21:49, 29 July 2008 (diff | hist) File:Jason.jpg (uploaded a new version of "Image:Jason.jpg") (top)
- 21:43, 29 July 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 21:34, 29 July 2008 (diff | hist) Team:The University of Alberta/Team (→Students)
- 17:08, 29 July 2008 (diff | hist) N Team:The University of Alberta/29 July 2008 (New page: ==The Big Whoops== We found the source of the problems we have been having with using NgoMIV and AgeI: the ER0x and BisDx parts dont have the NgoMIV and AgeI sites in them! Not good! We ma...)
- 23:54, 28 July 2008 (diff | hist) Team:The University of Alberta/28 July 2008 (→Today) (top)
- 17:06, 28 July 2008 (diff | hist) Team:The University of Alberta/28 July 2008
- 20:14, 24 July 2008 (diff | hist) Team:The University of Alberta/24 July 2008 (→System 2)
- 20:11, 24 July 2008 (diff | hist) Team:The University of Alberta/24 July 2008 (→System 2)
- 20:17, 21 July 2008 (diff | hist) Team:The University of Alberta/21 July 2008 (→Today)
- 20:09, 21 July 2008 (diff | hist) Team:The University of Alberta/21 July 2008 (→Today)
- 17:02, 21 July 2008 (diff | hist) Team:The University of Alberta/21 July 2008 (→Today)
- 17:01, 21 July 2008 (diff | hist) N Team:The University of Alberta/21 July 2008 (New page: ===Today=== *Transformed the ligation of Tryp into J6 *Finished Westerns of the Butanols suff in J6...RESULTS PENDING)
- 18:09, 18 July 2008 (diff | hist) Team:The University of Alberta/18 July 2008 (→Today)
- 18:09, 18 July 2008 (diff | hist) N Team:The University of Alberta/18 July 2008 (New page: ===Today=== *Got the sequencing back that Winnie did on the BisDA gene: it was LLC because she used the primers; no big deal though because the size was correct and we're pretty sure that ...)
- 18:06, 18 July 2008 (diff | hist) Team:The University of Alberta/17 July 2008 (→Today) (top)
- 17:05, 18 July 2008 (diff | hist) Team:The University of Alberta/17 July 2008 (→Today)
- 20:10, 17 July 2008 (diff | hist) N Team:The University of Alberta/17 July 2008 (New page: ===Today=== *Did Minipreps of I0500 in the new vector: Now we have I0500 in a high copy plasmid! No more adding IPTG to switch it from low-copy to high-copy mode! *More Colony PCR on the s...)
- 21:26, 16 July 2008 (diff | hist) Team:The University of Alberta/15 July 2008 (→Today) (top)
- 21:22, 16 July 2008 (diff | hist) Team:The University of Alberta/16 July 2008 (→Today) (top)
- 21:19, 16 July 2008 (diff | hist) Team:The University of Alberta/16 July 2008 (→Today)
- 17:25, 16 July 2008 (diff | hist) Team:The University of Alberta/16 July 2008 (→Today)
- 17:09, 16 July 2008 (diff | hist) N Team:The University of Alberta/16 July 2008 (New page: ===Today=== *The plates of Transformants of I0500 in the new vector turned out good **Did colony PCR on two colonies to confirm they have the I0500 insert ***Streaked out both colonies **...)
- 19:42, 15 July 2008 (diff | hist) Team:The University of Alberta/15 July 2008
- 18:14, 15 July 2008 (diff | hist) Team:The University of Alberta/11 July 2008 (top)
- 18:06, 15 July 2008 (diff | hist) N Team:The University of Alberta/14 July 2008 (New page: ==Today== *Took the sequencing of Blue Ox in J61003 Transf.2 and Transf.4 up to MBSU. Should get results tomorrow. *Ligated I0500 part and the new, high-copy vector together. Will transfor...) (top)
- 17:58, 15 July 2008 (diff | hist) Team:The University of Alberta/15 July 2008 (→Today)
- 17:57, 15 July 2008 (diff | hist) N Team:The University of Alberta/15 July 2008 (New page: ===Today=== *Got sequencing back from Blue Ox in J61003 Transf.2 and Transf. 4. Both of them look good; Transf.2 looks "better" though because it has fewer mismatches. *Did PCR on Tryp aga...)
- 19:50, 9 July 2008 (diff | hist) N Team:The University of Alberta/9 July 2008 (New page: ===Today== '''Chris'''<br> *Transformed Blue Ox in J61003 ligations 2 and 4; plated these (100ul and 400ul aliquots, 4 plates total)) (top)
- 20:26, 7 July 2008 (diff | hist) Team:The University of Alberta/7 July 2008 (→=Today) (top)
- 20:25, 7 July 2008 (diff | hist) N Team:The University of Alberta/7 July 2008 (New page: ===Today== '''Chris''' *Finished off the Westerns from last week. Again, no results. This isnt a surprise though, since the staining of the gels showed there was no protein on the gels, ev...)
- 17:34, 4 July 2008 (diff | hist) Team:The University of Alberta/4 July 2008 (→=Today)
- 17:34, 4 July 2008 (diff | hist) N Team:The University of Alberta/4 July 2008 (New page: ===Today== *Our Site-Directed Mutagenesis kit has arrived! That'll be fun to do! '''Chirs''' *Continuing with the protein stuff from yesterday. Transfering the gels to nitrocellulose membr...)
- 17:30, 4 July 2008 (diff | hist) Team:The University of Alberta
- 21:03, 3 July 2008 (diff | hist) Team:The University of Alberta/3 July 2008 (top)
- 17:07, 3 July 2008 (diff | hist) Team:The University of Alberta/27 June 2008 (→Today) (top)
- 17:05, 3 July 2008 (diff | hist) Team:The University of Alberta/27 June 2008 (→Today)
- 17:05, 3 July 2008 (diff | hist) N File:N120400274 33714509 398.jpg (top)
- 16:58, 3 July 2008 (diff | hist) N Team:The University of Alberta/3 July 2008 (New page: ===Today=== '''Chris'''<br> *After staining the gels from yesterday, there were no apparent bands. Could the Ni-NTA column purifications not have worked? Will run two more gels, with the c...)
- 16:53, 3 July 2008 (diff | hist) Team:The University of Alberta/2 July 2008
- 20:04, 27 June 2008 (diff | hist) Team:The University of Alberta/27 June 2008 (→Today)
- 20:04, 27 June 2008 (diff | hist) Team:The University of Alberta/25 June 2008 (→Today) (top)
- 20:02, 27 June 2008 (diff | hist) Team:The University of Alberta/27 June 2008 (→Today)
- 16:56, 27 June 2008 (diff | hist) N Team:The University of Alberta/27 June 2008 (New page: ==Today== *The O/Ns that were set up last night turned out well. Did mini-preps on them today. *The transformations done yesterday turned out perfectly. Now [[:Image:june27_transformants|...)
- 16:48, 27 June 2008 (diff | hist) N Team:The University of Alberta/26 June 2008 (New page: ==Today== *Did Colony PCR on Tom's transformants (22, 23, 25, 35 in I0500); ran on a gel - results were sketchy: lots of bands in each lane. We think this might be due to contamination in ...) (top)
- 17:39, 25 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 24) (top)
- 17:35, 25 June 2008 (diff | hist) N File:June24 thio rbs 6.jpg (top)
- 17:32, 25 June 2008 (diff | hist) N File:June24 thio rbs 4.jpg (top)
- 17:32, 25 June 2008 (diff | hist) N File:June24 thio rbs 2.jpg (top)
- 17:31, 25 June 2008 (diff | hist) N File:June24 thio rbs 1.jpg (top)
- 17:30, 25 June 2008 (diff | hist) N File:June24 tetRvr.jpg (top)
- 17:29, 25 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 24)
- 17:28, 25 June 2008 (diff | hist) N File:June24 vf.jpg (top)
- 16:46, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/Thio RBS 4 (New page: TTCNANTTACCTATAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT TCTGGAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGAAAAATTGTGTCATCGTCAGTGCGGTACGTACT GCTATCGGTAGTTTTAACGGTTCACT...) (top)
- 16:45, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/Thio RBS 3 (New page: TANGNTTACCTATAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTT CTGGAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAAT TCACTGGCCGTCGTTTTACAACGTCG...) (top)
- 16:45, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/Thio RBS 2 (New page: TTACCCTATAAAAATAGGGCGGTATCACGGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTNCCCTTNAGGATGATT TCTGGAATTCGCGGCCGCTTCTAGAGAANGAGGAGAAATACTAGATGAAAAATTGTGTCATCGTCAGTGCGGTACGTACT GCTATCGGTAGTTTTAACGGTTCACT...) (top)
- 16:44, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/Thio RBS 1 (New page: CTNTGNTTACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGAT TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACA ATTCACTGGCCGTCGTTTTACAACGT...) (top)
- 16:43, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/TetR Vr (New page: CGTNCCACCGACGACGAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAGCGGCCGCTACTAGTAGCGATCTACACTAGC ACTATCAGTGTTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCGGACCCACTTTCACATTTAAGTTGTTTTTCT AATCCGCATATGATCAATTCAAGGCC...) (top)
- 16:43, 25 June 2008 (diff | hist) N Team:The University Of Alberta/Sequencing/June 24/TetR Vf (New page: CTNCGNCTTACCTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCNCTNAGGATGATT TCTGGAATTCGCGGCCGCTTCTAGATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGA GGTCGGAATCGAAGGTTTAACAACCC...) (top)
- 16:41, 25 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 24)
- 16:37, 25 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 24)
- 16:35, 25 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 24)
- 16:30, 25 June 2008 (diff | hist) N Team:The University of Alberta/25 June 2008 (New page: ==Today== *Got more sequencing back again today (sequencing of TetR [Chris] and Thiolase+RBS Colonies 1, 2, 4 and 6 [Tom]). Everything looks good this time. Sequences and chromatograms are...)
- 17:20, 24 June 2008 (diff | hist) Team:The University of Alberta/24 June 2008 (→Today) (top)
- 17:03, 24 June 2008 (diff | hist) Team:The University of Alberta/Sequencing
- 17:01, 24 June 2008 (diff | hist) Team:The University of Alberta/Sequencing
- 16:40, 24 June 2008 (diff | hist) N Team:The University of Alberta/24 June 2008 (New page: ==Today== *Got the sequencing results from the sequencing done Friday/Saturday/Monday. Another case of LLC (Looks Like Crap). Winnie is redoing the whole shebang (colony PCR -> gel purific...)
- 00:04, 24 June 2008 (diff | hist) N File:Chris bisphenolics.jpg (top)
- 00:04, 24 June 2008 (diff | hist) Team:The University of Alberta/23 June 2008 (→Logo Design)
- 00:00, 24 June 2008 (diff | hist) Team:The University of Alberta/23 June 2008 (→Today)
- 20:35, 23 June 2008 (diff | hist) Team:The University of Alberta/23 June 2008 (→Today)
- 20:05, 23 June 2008 (diff | hist) N Team:The University of Alberta/23 June 2008 (New page: ==Today== *Winnie finished off the sequencing on Purple Russian Colony #5 from last week. *Tom set up six O/N cultures (Colonies 1-6) of B0034+Thiolase)
- 16:35, 23 June 2008 (diff | hist) N Team:The University of Alberta/Parts/Plastic/BisDB sequence (New page: '''gaattcgcggccgcttctag'''ATGGCTGGTAACCCACAAACTCTGCCGGTATTTCCAGACCTGGATATCTT CAGCCCGGAATACGCTTGTAACCGCGAAAAATATGCAGCGCGTGCGCTGCGCGATTACCCGC TGCACTTTTATAAACCGCTGAACCTGTGGATTGTCTCCAAACATAAAG...) (top)
- 16:33, 23 June 2008 (diff | hist) Team:The University of Alberta/Parts/Plastic/BisDA sequence (top)
- 16:31, 23 June 2008 (diff | hist) N Team:The University of Alberta/Parts/Plastic/BisDA sequence (New page: '''gaattcgcggccgcttctag'''ATGGCAGGTCCTCATATCCAAGTTACGACTCGTGATGGTGAAATTCGCGAGCTGGACGTTGCAGCTTCCGGTTTCCTGATGGAAGCGCTGCGTGACGCTAACATCGATGGTGTGGAGGCGATGTGTGGCGGTTGCTGTTCTTGCGCGACTTGCCACGTCTAC...)
- 16:30, 23 June 2008 (diff | hist) Team:The University of Alberta/Parts (→Plastic Project)
- 16:28, 23 June 2008 (diff | hist) Team:The University of Alberta/Parts/Plastic/lacI ERE sequence (top)
- 16:27, 23 June 2008 (diff | hist) N Team:The University of Alberta/Parts/Plastic/lacI ERE sequence (New page: gaattcgcggccgcttctagatggtgcaaaacctttcgcggtatggcatgatagcgccaggtcagagtgacctactagtagcggccgctg cag)
- 16:27, 23 June 2008 (diff | hist) Team:The University of Alberta/Parts (→Plastic Project)
- 16:16, 23 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today) (top)
- 22:26, 20 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today)
- 22:25, 20 June 2008 (diff | hist) N File:June20 purple russian 5 colonypcr.jpg (top)
- 20:30, 20 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 19/Purple Russian Colony 5 Pf (New page: LLC) (top)
- 20:30, 20 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 19/Purple Russian Colony 5 Vf (New page: LLC) (top)
- 20:29, 20 June 2008 (diff | hist) N File:June19 colony 5 pf.jpg (top)
- 20:28, 20 June 2008 (diff | hist) N File:June19 colony 5 vf.jpg (top)
- 20:24, 20 June 2008 (diff | hist) Team:The University of Alberta/Sequencing
- 20:14, 20 June 2008 (diff | hist) Team:The University of Alberta/Project
- 20:13, 20 June 2008 (diff | hist) Team:The University of Alberta/Project (→Sequencing Results)
- 20:13, 20 June 2008 (diff | hist) Team:The University of Alberta/Project (→Journals)
- 17:48, 20 June 2008 (diff | hist) Team:The University of Alberta (→Special Thanks)
- 17:43, 20 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:41, 20 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today)
- 17:37, 20 June 2008 (diff | hist) Team:The University of Alberta/20 June 2008 (→Today)
- 17:26, 20 June 2008 (diff | hist) N Team:The University of Alberta/20 June 2008 (New page: ==Today== *Got the sequencing results back from the "Purple Russian Colony #5" sequencing that Winnie did. Looks like it didn't work at all (see the [[Team:The_University_of_Alberta/Sequen...)
- 17:50, 19 June 2008 (diff | hist) N Team:The University of Alberta/19 June 2008 (New page: ==Today== '''Chris''' *More work on the Westerns *Did a miniprep of the TetR biobrick from the iGEM Parts binder. Concentration = 146.0ng/ul. Placed in "Miniprep 2" box.)
- 17:46, 18 June 2008 (diff | hist) N File:Blue ox june17edit.jpg (top)
- 17:46, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Blue Ox (New page: ACCCNNNNATGNAAGNNGAANANGGCCNCATNTGAAGCGGCCNCATCTNCCAGTCTTCGTCGACAAANCCNTNGAGGTCT GTTCTTGTTGCCGCTGCCCAAGAGTTGTTANTCCAACCTAAGAATAGAATTATACCATTTTCAGCGGGAGCTAATTTACT AGAAGTTCTCAGAGAGAACGGTGTTG...) (top)
- 17:46, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:38, 18 June 2008 (diff | hist) N File:Tryp june17edit.jpg (top)
- 17:38, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Tryp (New page: TNNNNNGNNNTGNNATNNTGNANATTGNATCCTCGGCACNTTCACNCTCGCNTACTTTCTTCCGTCTTCGTCGACAAAGC CAACGNTNGATCNTGTTCTTGTTGCCGCTGCCCAAAAGGATTACGTCATGGAGAACTTCAAGCATCTGCCAGAGCCATTT AGAATAAGAGTCATCGAGCCTGTTAA...) (top)
- 17:37, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:28, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:27, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:27, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:26, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:25, 18 June 2008 (diff | hist) N File:Purple russian june17edit.jpg (top)
- 17:25, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17/Purple Russian (New page: AGAGACTATGCCATTTAAGACAACCATCGAGGGAACGGTAAACGGGCATTNCNTTCAAGTGTACTGGTAAGGGAGAGGGT AATCCATTTGAAGGCNCACAGGAGATGAAGATAGAGGTTATTGAAGGAGGACCTCTTCCTTTCGCTTTCCACATTTTGTC TACCTCATGCATGTACGGCTCCAAGA...) (top)
- 17:24, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing (→June 17)
- 17:24, 18 June 2008 (diff | hist) Team:The University of Alberta/Sequencing/June 17 (Removing all content from page) (top)
- 17:23, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing/June 17 (New page: AGAGACTATGCCATTTAAGACAACCATCGAGGGAACGGTAAACGGGCATTNCNTTCAAGTGTACTGGTAAGGGAGAGGGT AATCCATTTGAAGGCNCACAGGAGATGAAGATAGAGGTTATTGAAGGAGGACCTCTTCCTTTCGCTTTCCACATTTTGTC TACCTCATGCATGTACGGCTCCAAGA...)
- 17:22, 18 June 2008 (diff | hist) N Team:The University of Alberta/Sequencing (New page: ==June 17== Purple Russian in J61003 from Transformed Colonies: Sequence | Chromatogram)
- 17:16, 18 June 2008 (diff | hist) N Team:The University of Alberta/18 June 2008 (New page: '''Today''' *Got the sequences back that Jason did yesterday. They look good (aligned to the reference sequences, and they matched). The sequences have been added to a [[Team:The_Universit...)
- 20:37, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→Troubleshooting Results)
- 19:42, 17 June 2008 (diff | hist) N File:June17 puc57 genes.jpg (top)
- 19:42, 17 June 2008 (diff | hist) Team:The University of Alberta/17 June 2008 (→Troubleshooting Results)
- 17:38, 17 June 2008 (diff | hist) N Team:The University of Alberta/17 June 2008 (New page: ==Today== Today we are continuing the troubleshooting from yesterday. ==Troubleshooting Results== '''Saima'''<br> Tried doing digests from ...)
- 16:10, 17 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results) (top)
- 22:43, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results)
- 22:41, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008 (→Troubleshooting Results)
- 22:41, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008
- 17:39, 16 June 2008 (diff | hist) Team:The University of Alberta/16 June 2008
- 17:21, 16 June 2008 (diff | hist) N Team:The University of Alberta/16 June 2008 (New page: ==Troubleshooting Day== We have been getting alot of bad results (or no results at all) in the lab lately - our gel purifications have had very low yields, the Westerns have no been workin...)
- 19:53, 13 June 2008 (diff | hist) Team:The University of Alberta/13 June 2008 (→Today) (top)
- 17:47, 13 June 2008 (diff | hist) Team:The University of Alberta/13 June 2008
- 17:41, 13 June 2008 (diff | hist) N Team:The University of Alberta/13 June 2008 (New page: ==Today== *Developed the Westerns after an overnight exposure. Blank yet again. James thought the problem was due to the development solution used - it was an old tube in the fridge that h...)
- 17:35, 13 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today) (top)
- 16:32, 13 June 2008 (diff | hist) N File:June12 colony pcr.jpg (top)
- 16:29, 13 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 19:45, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 19:44, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008 (→Today)
- 17:17, 12 June 2008 (diff | hist) Team:The University of Alberta/12 June 2008
- 19:46, 11 June 2008 (diff | hist) Team:The University of Alberta/11 June 2008 (→To Do) (top)
- 16:39, 11 June 2008 (diff | hist) N Team:The University of Alberta/11 June 2008 (New page: ==Today== *The Ni-NTA columns have finally arrived! *Got the results back from Winnie's sequencing of the BlueOx BioBrick; they didn't look good. She is going to redo the sequencing (colon...)
- 20:30, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 20:29, 10 June 2008 (diff | hist) m Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 20:29, 10 June 2008 (diff | hist) N File:25 35 thio crude soluable edit.jpg (top)
- 20:28, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008 (→Not so Strange Things)
- 17:30, 10 June 2008 (diff | hist) Team:The University of Alberta/10 June 2008
- 17:00, 10 June 2008 (diff | hist) N Team:The University of Alberta/10 June 2008 (New page: ==The Day of Strange Results== *The Purple Russian transformants did not grow yet again. This time it might be because Jason made a mistake while transforming the competent cells. We shoul...)
- 21:53, 9 June 2008 (diff | hist) Team:The University of Alberta/9 June 2008 (top)
- 18:12, 9 June 2008 (diff | hist) N File:Project diagram.jpg (top)
- 18:11, 9 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta (→The Project)
- 18:11, 9 June 2008 (diff | hist) Team:University of Alberta/Plastic Project:The University of Alberta
- 17:01, 9 June 2008 (diff | hist) N Team:The University of Alberta/9 June 2008 (New page: '''To Do''': *check to see if Ni-Columns have arrived *Finish westerns '''Today''':<br> *Checked the transformants Anthony did on the weekend. The Purple Russian had no growth at all :( T...)
- 22:56, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→To Do) (top)
- 22:54, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→To Do)
- 22:46, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 19:56, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 17:12, 6 June 2008 (diff | hist) Team:The University of Alberta/6 June 2008 (→Today)
- 17:09, 6 June 2008 (diff | hist) N Team:The University of Alberta/6 June 2008 (New page: ==Today== *We got the new reverse primers for Purple Russian and Tryp in today. We set up PCR using these reverse primers with the forward primers for Purple Russian and Tryp that we got l...)
- 21:28, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 21:26, 5 June 2008 (diff | hist) Team:The University of Alberta/Project (→Estrogen Receptors)
- 21:10, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick) (top)
- 21:03, 5 June 2008 (diff | hist) N Team:The University of Alberta/Butanerd (New page: '''The Butanerd project from last year is still alive and kicking! Here is where we will put all the info on the work we've done this year on our butanol biofuel.''')
- 21:02, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 21:01, 5 June 2008 (diff | hist) Team:The University of Alberta/Project
- 20:59, 5 June 2008 (diff | hist) N File:Butanerd button.jpg (top)
- 20:54, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick)
- 20:28, 5 June 2008 (diff | hist) N File:Blue ox confirm.jpg (top)
- 20:28, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008 (→Our First BioBrick)
- 20:27, 5 June 2008 (diff | hist) Team:The University of Alberta/5 June 2008
- 16:22, 5 June 2008 (diff | hist) N Team:The University of Alberta/5 June 2008 (New page: ==To Do Today== *confirm Blue Ox Biobrick *plant plants *water plants in the growth chamber *colony PCR for all of the butanol biobricks in both J61003 and I0500 *read lots of papers! *fin...)
- 22:58, 4 June 2008 (diff | hist) Team:The University of Alberta/4 June 2008 (top)
- 22:53, 4 June 2008 (diff | hist) Team:The University of Alberta/4 June 2008
- 16:28, 4 June 2008 (diff | hist) N Team:The University of Alberta/4 June 2008 (New page: '''Continued From Yesterday...'''<br> Anthony did a miniprep of our putative Blue Ox + suffix/prefix yesterday evening; David then did a digest of this with EcoRI and PstI to determine if ...)
- 22:01, 3 June 2008 (diff | hist) Team:The University of Alberta/Project (→Other Info)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)