Team:Paris/August 11

From 2008.igem.org

(Difference between revisions)
(Transformation)
(Culture of ligation transformants)
 
(7 intermediate revisions not shown)
Line 2: Line 2:
==Transformation==
==Transformation==
 +
All the ligations were transformed according  [[Team:Paris/Notebook/Protocols#Transformation|transformation for Top10 protocol]]
 +
-
* [[Team:Paris/Notebook/Protocols#Transformation|Protocol for Top 10 cells]] : (see # '''13''')
 
-
==Digestion==
 
==PCR==
==PCR==
Line 120: Line 120:
|MP143
|MP143
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_131
+
|PCR_130'
| -
| -
|O141_O140
|O141_O140
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_132
+
|PCR_131
|flhD RBS-
|flhD RBS-
|O132_O133
|O132_O133
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_133
+
|PCR_131'
| -
| -
|O132_O133
|O132_O133
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_134
+
|PCR_132
|flhC RBS-
|flhC RBS-
|O130_O131
|O130_O131
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_135
+
|PCR_132'
| -
| -
|O130_O131
|O130_O131
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_136
+
|PCR_133
|flhDC + prom
|flhDC + prom
|O110_O131
|O110_O131
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_137
+
|PCR_133'
| -
| -
|O110_O131
|O110_O131
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_138
+
|PCR_134
|flhDC + prom
|flhDC + prom
|O111_O131
|O111_O131
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_139
+
|PCR_134'
| -
| -
|O111_O131
|O111_O131
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_140
+
|PCR_135
|pfliL
|pfliL
|O124_O125
|O124_O125
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_141
+
|PCR_135'
| -
| -
|O124_O125
|O124_O125
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_142
+
|PCR_136
|pflhDC
|pflhDC
|O110_O113
|O110_O113
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_143
+
|PCR_136'
| -
| -
|O110_O113
|O110_O113
|Water
|Water
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_144
+
|PCR_137
|pflhDC
|pflhDC
|O111_O113
|O111_O113
|MG1655
|MG1655
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_145
+
|PCR_137'
| -
| -
|O111_O113
|O111_O113
Line 230: Line 230:
|style="background: #cbff7B"|<center> 900 bp </center>
|style="background: #cbff7B"|<center> 900 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_131
+
|PCR_130'
|Negative Control
|Negative Control
|Gel 1
|Gel 1
Line 237: Line 237:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_132
+
|PCR_131
|flhD RBS-
|flhD RBS-
|Gel 1
|Gel 1
Line 244: Line 244:
|style="background: #cbff7B"|<center> 350 bp </center>
|style="background: #cbff7B"|<center> 350 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_133
+
|PCR_131'
|Negative Control
|Negative Control
|Gel 1
|Gel 1
Line 251: Line 251:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_134
+
|PCR_132
|flhC RBS-
|flhC RBS-
|Gel 1
|Gel 1
Line 258: Line 258:
|style="background: #cbff7B"|<center> 600 bp </center>
|style="background: #cbff7B"|<center> 600 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_135
+
|PCR_132'
|Negative Control
|Negative Control
|Gel 1
|Gel 1
Line 265: Line 265:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_136
+
|PCR_133
|flhDC + prom
|flhDC + prom
|Gel 2
|Gel 2
Line 272: Line 272:
|style="background: #cbff7B"|<center> 1300 bp </center>
|style="background: #cbff7B"|<center> 1300 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_137
+
|PCR_133'
|Negative Control
|Negative Control
|Gel 2
|Gel 2
Line 279: Line 279:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_138
+
|PCR_134
|flhDC + prom
|flhDC + prom
|Gel 2
|Gel 2
Line 286: Line 286:
|style="background: #ff6d73"|<center> 2100 pb </center>
|style="background: #ff6d73"|<center> 2100 pb </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_139
+
|PCR_134'
|Negative Control
|Negative Control
|Gel 2
|Gel 2
Line 295: Line 295:
-
==> '''Conclusion :''' We observed the size expected for the PCR products, but not for pflhDC (PCR_138), is right. We hypothesis for PCR_138 that the size is longer that expected due to the aspecific fixation of Oligo O111 (upper to the real site).
+
==> '''Conclusion :''' We observed the size expected for the PCR products, but not for pflhDC (PCR_134), is right. We hypothesis for PCR_138 that the size is longer that expected due to the aspecific fixation of Oligo O111 (upper to the real site).
Line 315: Line 315:
|align="center"|'''Measured size'''
|align="center"|'''Measured size'''
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_140
+
|PCR_135
|pfliL
|pfliL
|Gel 3
|Gel 3
Line 322: Line 322:
|style="background: #ff6d73"|<center> 0 bp </center>
|style="background: #ff6d73"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_141
+
|PCR_135'
|Negative Control
|Negative Control
|Gel 3
|Gel 3
Line 329: Line 329:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_142
+
|PCR_136
|pflhDC
|pflhDC
|Gel 3
|Gel 3
Line 336: Line 336:
|style="background: #ff6d73"|<center> 0 bp </center>
|style="background: #ff6d73"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_143
+
|PCR_136'
|Negative Control
|Negative Control
|Gel 3
|Gel 3
Line 343: Line 343:
|style="background: #cbff7B"|<center> 0 bp </center>
|style="background: #cbff7B"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_144
+
|PCR_137
|pflhDC
|pflhDC
|Gel 3
|Gel 3
Line 350: Line 350:
|style="background: #ff6d73"|<center> 0 bp </center>
|style="background: #ff6d73"|<center> 0 bp </center>
|- style="text-align: center;"
|- style="text-align: center;"
-
|PCR_145
+
|PCR_137'
|Negative Control
|Negative Control
|Gel 3
|Gel 3
Line 359: Line 359:
-
==> '''Conclusion :''' We need to do again the experience
+
==> '''Conclusion :''' We need to repeat the experiments.
-
==Culture of ligation transformants==
+
==Culture of ligation transformants (pFlgA, pFlgB and pFlhB)==
*4 clones of each transformation were cultured in '''7,5 mL LB + ampicilline'''. The colonies picked up were the rest of those already picked up from the transformation plate (for the PCR screening of August 8).
*4 clones of each transformation were cultured in '''7,5 mL LB + ampicilline'''. The colonies picked up were the rest of those already picked up from the transformation plate (for the PCR screening of August 8).

Latest revision as of 16:11, 18 August 2008

← Yesterday

↓ Calendar ↑

Tomorrow →

Contents

Transformation

All the ligations were transformed according transformation for Top10 protocol


PCR

We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.


PCR amplification

Protocol

  • List of Oligos :
Number Name Sequence Length Comments
O110 FlhDC-Uri-F GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGTATGTGCGTGTAGTGACGAGTACAG 58 Don't amplify the both OmpR binding site
O111 FlhDC-Total-F GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCATTTTTGCTTGCTAGCGTACGGAAAA 58 Amplify the both OmpR binding site
O113 FlhDC(nu)-R GTTTCTTCCTGCAGCGGCCGCTACTAGTACAGAATAACCAACTTTATTTTTATG 54 Don't amplify the natural rbs of FlhD (only promoter)
O124 Oligo-pfliL-Forward-TRO TCGAATTCGCGGCCGCTTCTAGAGCAAGGGCGTGTAACAGGCAAC 45
O125 Oligo-pfliL-Reverse-TRO TCCTGCAGCGGCCGCTACTAGTAGTCATGTGTTGCGGTCTTCCTGTG 47
O130 Gene-FlhC-F GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGTGAAAAAAGCATTGTTCAGG 53
O131 Gene-FlhC-R-TRO GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAACAGCCTGTACTCTCTGTTCATCC 60
O132 Gene-FlhD-F GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC 53 Don't amplify the natural rbs of FlhD
O133 Gene-FlhD-R-TRO GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGGCCCTTTTCTTGCGCAGCGCTTCT 60
O140 PlasTest_GFP_Rv CCCTGCAGTTAATTAATATAAACGCAGAAAGGCCAC 36 Amplify E0240 with a PacI and a PstI restriction site at the end
O141 PTst_GFPrbs+_F GCCTGCAGTCACACAGGAAAGTACTAGATGC 31 Amplify E0240 with the promoter and a PstI restriction site at the beginning


  • Preparation of the templates :
    Resuspension of 1 colony in 100µl of water.


  • Preparation of PCR mix :

For each sample,

1 µl dNTP
10 µl Buffer Phusion 5x
2,5 µl Oligo_F
2,5 µl Oligo_R
1µl template
1 µl Phusion
50 µl qsp H2O (33µl)


Name genes Oligo templates
PCR_130 E0240 RBS+ O141_O140 MP143
PCR_130' - O141_O140 Water
PCR_131 flhD RBS- O132_O133 MG1655
PCR_131' - O132_O133 Water
PCR_132 flhC RBS- O130_O131 MG1655
PCR_132' - O130_O131 Water
PCR_133 flhDC + prom O110_O131 MG1655
PCR_133' - O110_O131 Water
PCR_134 flhDC + prom O111_O131 MG1655
PCR_134' - O111_O131 Water
PCR_135 pfliL O124_O125 MG1655
PCR_135' - O124_O125 Water
PCR_136 pflhDC O110_O113 MG1655
PCR_136' - O110_O113 Water
PCR_137 pflhDC O111_O113 MG1655
PCR_137' - O111_O113 Water


  • Program PCR_Screening : Annealing 30" at 60°C - Time élongation 1'30" at 72°C - Number cycle : 30

PCR verification/Analysis

Analysis of PCR product (Gel 1)
Analysis of PCR product (Gel 2)

After the PCR :

  • 2*3µl have been analysed by electrophoresis
  • the other 44µl of PCR products have been purified by the Promega kit.


  • Electrophoresis

ladder : 10µl ladder 1 kb
samples : 3µl of PCR products + 2µl of Loading Dye
migration 30min at 100V, on a 1% agarose gel


  • Results :
Name Promotor Gel Band Expected size Measured size
PCR_130 E0240 Gel 1 2 876 bp
900 bp
PCR_130' Negative Control Gel 1 3 0 bp
0 bp
PCR_131 flhD RBS- Gel 1 4 351 bp
350 bp
PCR_131' Negative Control Gel 1 5 0 bp
0 bp
PCR_132 flhC RBS- Gel 1 6 579 bp
600 bp
PCR_132' Negative Control Gel 1 7 0 bp
0 bp
PCR_133 flhDC + prom Gel 2 2 1165 bp
1300 bp
PCR_133' Negative Control Gel 2 3 0 bp
0 bp
PCR_134 flhDC + prom Gel 2 4 1311 bp
2100 pb
PCR_134' Negative Control Gel 2 5 0 bp
0 pb


==> Conclusion : We observed the size expected for the PCR products, but not for pflhDC (PCR_134), is right. We hypothesis for PCR_138 that the size is longer that expected due to the aspecific fixation of Oligo O111 (upper to the real site).


  • Electrophoresis
Analysis of PCR product (Gel 3)

ladder : 10µl ladder 100 bp
samples : 3µl of PCR products + 2µl of Loading Dye
migration 30min at 100V, on a 2% agarose gel


  • Results :
Name Promotor Gel Band Expected size Measured size
PCR_135 pfliL Gel 3 2 124 bp
0 bp
PCR_135' Negative Control Gel 3 3 0 bp
0 bp
PCR_136 pflhDC Gel 3 4 223
0 bp
PCR_136' Negative Control Gel 3 5 0 bp
0 bp
PCR_137 pflhDC Gel 3 6 369
0 bp
PCR_137' Negative Control Gel 3 7 0 bp
0 bp


==> Conclusion : We need to repeat the experiments.

Culture of ligation transformants (pFlgA, pFlgB and pFlhB)

  • 4 clones of each transformation were cultured in 7,5 mL LB + ampicilline. The colonies picked up were the rest of those already picked up from the transformation plate (for the PCR screening of August 8).
  • 37°C overnight
Ligation L128 L129 L130
Name pFlgA pFlgB pFlhB
Clone N° 1 2 3 4 1 2 6 7 1 2 7 8
Red fluorescence yes yes no no yes yes no no yes no no no