Team:Paris/August 8

From 2008.igem.org

(Difference between revisions)

Revision as of 10:29, 11 August 2008

Minipreps : Plasmid extraction

Extraction of pSB3K3 et E0240 in pSB1A2 plasmid from overnight bacteria culture using the QIAspin Miniprep Kit (QIAGEN) by QIACube.

Carried out 2 times (2 tubes)

name	Biobrick	plasmid
MP142	-	pSB3K3
MP143	E0240	pSB1A2

Amplification of Genes of interest (OmpR, EnvZ, FlhDC)

We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.

PCR Protocol

List of Oligos :

Number	Name	Sequence	Length	Comments
O126	Gene-EnvZ-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGGCGATTGCGCTTCTCGCCAC	53
O127	Gene-EnvZ-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTACCCTTCTTTTGTCGTGCCCTGCGCC	59
O131	Gene-FlhC-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTAAACAGCCTGTACTCTCTGTTCATCC	59
O132	Gene-FlhD-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC	53	Don't amplify the natural rbs of FlhD
O138	Gene-OmpR-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCAAGAGAACTACAAGATTCTGG	53
O139	Gene-OmpR-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTATGCTTTAGAGCCGTCCGGTACAAAG	59

Transformation results

Name	Description	Antibio	Number of colonies	Number of red fluorescent colonies
Ligation
L128	J61002-pFlgA D136 (FV) - D132 (FI)	Amp	~ 400	2
L129	J61002-pFlgB D136 (FV) - D133 (FI)	Amp	39	5
L130	J61002-pFlhB D136 (FV) - D134 (FI)	Amp	~ 1000	4 (but 3 are on the edge of the petri dishe)
L131	J61002-pFlhDC D136 (FV) - D135 (FI)	Amp	39	38
Control
Control 1	D136	Amp	0	0
Positive control	pUC19	Amp	36	0

PCR Screening of Ligation Transformants

Use of 8 clones of Ligation transformants for screening PCR

Ligation	Name	n° clone	fluorescence
L128	pFlgA	1	red
		2	red
		3	no
		4	no
		5	no
		6	no
		7	no
		8	no
L129	pFlgB	1	red
		2	red
		3	red
		4	red
		5	red
		6	no
		7	no
		8	no
L130	pFlhB	1	red
		2	no
		3	no
		4	no
		5	no
		6	no
		7	no
		8	no
L131	pFlgB	1	red
		2	red
		3	red
		4	red
		5	red
		6	red
		7	red
		8	no

Protocol of screening PCR

Mix

Name	Vol (µl)	Concentration
Quick Load	25µl	2X
OligoF_VF2 (O18)	1µl	10µM
OligoR_VR (O19)	1µl	10µM
water	23µl

50µl of Mix PCR by tube/clone
one toothpick of each clone's colony by tube
Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29

Conditions of electrophoresis

10µl of ladder 100 pb
10µl of screening PCR
migration ~30min at 100W on 1,5% gel

Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29

Electrophoresis Purification of PCR

When the PCR cycles were finished,

conditions :

10µl of ladder 1 kb (unlike 100 pb)
2 x 30µl of PCR products added with 10µl of loading Dye 6x
migration ~30min at 100W on a 1,5% agarose gel.

Results of electrophoresis

gel 1 gel 2

Name	Promotor	Gel	Band	Expected size	Measured size
PCR_124'	pFlgA	1	2 to 9	261 pb	300 pb
PCR_125'	pFlgB	1	10 to 17	261 pb	300 pb
PCR_126'	pFlhB	2	2 to 9	260 pb	300 pb
PCR_127'	pFlhDC	2	10 to 17	446 pb	1,000 pb

==> Conclusion:

PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the oligos wich are not specific.

@@ Line 83: / Line 83: @@
-==== Protocol PCR ====
-''For each samples,''
-* '''Preparation of the templates''' :<br>--> Resuspend of 1 colony in 100µl of water.
-* '''Preparation of PCR mix''' :
-µl dNTP
-<br>10 µl Buffer Phusion 5x
-<br>2,5 µl Oligo_F
-<br>2,5 µl Oligo_R
-<br>1µl template
-<br>1 µl Phusion
-<br>50 µl qsp H2O (33µl)
-*
-{| border="1"
-|align="center"|'''Name'''
-|align="center"|'''Genes'''
-|align="center"|'''Oligo'''
-|align="center"|'''Templates'''
-|-
-|align="center"|PCR_127
-|align="center"|FlhDC
-|align="center"|O131_O132
-|align="center"|MG1655
-|-
-|align="center"|PCR_128
-|align="center"|OmpR
-|align="center"|O138_O139
-|align="center"|strain OmpR*
-|-
-|align="center"|PCR_129
-|align="center"|EnvZ
-|align="center"|O126_O127
-|align="center"|strain EnvZ*
-|-
-|align="center"|PCR_Control -
-|align="center"| -
-|align="center"|O126_O127
-|align="center"|Water
-|}
-<br>
-* Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29
-=== Electrophoresis Purification of PCR===
-''When the PCR cycles were finished,''
-'''conditions :'''
-* 10µl of ladder 1 kb (unlike 100 pb)
-* 2 x 30µl of PCR products added with 10µl of loading Dye 6x
-* migration ~30min at 100W on a '''1,5% agarose gel'''.
-'''Results of electrophoresis'''
-<br>gel 1 [[Image:KR000.jpg| gel 1|150px]]
-gel 2 [[Image:KR000.jpg|gel 2|145px]]
-{|- border="1"
-|align="center"|'''Name'''
-|align="center"|'''Promotor'''
-|align="center"|'''Gel'''
-|align="center"|'''Band'''
-|align="center"|'''Expected size'''
-|align="center"|'''Measured size'''
-|-
-|align="center"|PCR_124
-|align="center"|pFlgA
-|align="center"|1
-|align="center"|2-3
-|style="background: #cbff7B"|<center>261 pb</center>
-|align="center"|300 pb
-|-
-|align="center"|PCR_125
-|align="center"|pFlgB
-|align="center"|1
-|align="center"|4-5
-|style="background: #cbff7B"|<center>261 pb</center>
-|align="center"|300 pb
-|-
-|align="center"|PCR_126
-|align="center"|pFlhB
-|align="center"|2
-|align="center"|5-6
-|style="background: #cbff7B"|<center>260 pb</center>
-|align="center"|300 pb
-|-
-|align="center"|PCR_127
-|align="center"|pFlhDC
-|align="center"|1 & 2
-|align="center"|7 & 2
-|style="background: #ff6d73"|<center>446 pb</center>
-|align="center"|1,000 pb
-|}
-==> '''Conclusion:'''
-* After electrophoresis, the bands corresponding to the right amplification were excised and purified using the Promega protocol.
-* Elution in 30 µL of buffer EB.
-* Store at -20°C
 ==Transformation results==
@@ Line 255: / Line 145: @@
 |align="center"|'''fluorescence'''
 |-
-|rowspan="8"align="center"|L128
+| rowspan="8" align="center"|L128
-|rowspan="8"align="center"|pFlgA
+| rowspan="8" align="center"|pFlgA
 |align="center"|1
 |align="center"|red
 |-
-|
-|
 |align="center"|2
 |align="center"|red
 |-
-|
-|
 |align="center"|3
 |align="center"|no
 |-
-|
-|
 |align="center"|4
 |align="center"|no
 |-
-|
-|
 |align="center"|5
 |align="center"|no
 |-
-|
-|
 |align="center"|6
 |align="center"|no
 |-
-|
-|
 |align="center"|7
 |align="center"|no
 |-
-|
-|
 |align="center"|8
 |align="center"|no
 |-
-|rowspan="8"align="center"|L129
+| rowspan="8" align="center"|L129
-|rowspan="8"align="center"|pFlgB
+| rowspan="8" align="center"|pFlgB
 |align="center"|1
 |align="center"|red
 |-
-|
-|
 |align="center"|2
 |align="center"|red
 |-
-|
-|
 |align="center"|3
 |align="center"|red
 |-
-|
-|
 |align="center"|4
 |align="center"|red
 |-
-|
-|
 |align="center"|5
 |align="center"|red
 |-
-|
-|
 |align="center"|6
 |align="center"|no
 |-
-|
-|
 |align="center"|7
 |align="center"|no
 |-
-|
-|
 |align="center"|8
 |align="center"|no
 |-
-|rowspan="8"align="center"|L130
+| rowspan="8" align="center"|L130
-|rowspan="8"align="center"|pFlhB
+| rowspan="8" align="center"|pFlhB
 |align="center"|1
 |align="center"|red
 |-
-|
-|
 |align="center"|2
 |align="center"|no
 |-
-|
-|
 |align="center"|3
 |align="center"|no
 |-
-|
-|
 |align="center"|4
 |align="center"|no
 |-
-|
-|
 |align="center"|5
 |align="center"|no
 |-
-|
-|
 |align="center"|6
 |align="center"|no
 |-
-|
-|
 |align="center"|7
 |align="center"|no
 |-
-|
-|
 |align="center"|8
 |align="center"|no
 |-
-|rowspan="8"align="center"|L131
+| rowspan="8" align="center"|L131
-|rowspan="8"align="center"|pFlgB
+| rowspan="8" align="center"|pFlgB
 |align="center"|1
 |align="center"|red
 |-
-|
-|
 |align="center"|2
 |align="center"|red
 |-
-|
-|
 |align="center"|3
 |align="center"|red
 |-
-|
-|
 |align="center"|4
 |align="center"|red
 |-
-|
-|
 |align="center"|5
 |align="center"|red
 |-
-|
-|
 |align="center"|6
 |align="center"|red
 |-
-|
-|
 |align="center"|7
 |align="center"|red
 |-
-|
-|
 |align="center"|8
 |align="center"|no
@@ Line 459: / Line 293: @@
-===Results for L128===
+* Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29
+=== Electrophoresis Purification of PCR===
+''When the PCR cycles were finished,''
+'''conditions :'''
+* 10µl of ladder 1 kb (unlike 100 pb)
+* 2 x 30µl of PCR products added with 10µl of loading Dye 6x
+* migration ~30min at 100W on a '''1,5% agarose gel'''.
+'''Results of electrophoresis'''
-==Preparation of the newly ammplified promoters==
+<br>gel 1 [[Image:KR000143.jpg‎ | gel 1|200px]]
-===Electrophoresis of the PCR products made [[Team:Paris/August_6|yesterday]]===
+gel 2 [[Image:KR000145.jpg|gel 2|200px]]
-[[image:KR000116.jpg|thumb|Standart PCR to amplify pflgA, pflgB and pflhB(Gel1)]]
-[[image:KR000117.jpg|thumb|PCR with gradient to amplify pflhDC(Gel2)]]
-'''Electrophoresis settings'''
-* Gel : 1.5 % agar
-* 3µL template DNA
-* 10µL QuickLoad DNA ladder 100 bp
-{|- align = "center" | border="1"
+{|- border="1"
-|'''Name'''
+|align="center"|'''Name'''
-|'''Promotor'''
+|align="center"|'''Promotor'''
 |align="center"|'''Gel'''
 |align="center"|'''Band'''
@@ Line 478: / Line 321: @@
 |align="center"|'''Measured size'''
 |-
-|align="center"|PCR_124
+|align="center"|PCR_124'
 |align="center"|pFlgA
 |align="center"|1
-|align="center"|2
+|align="center"|2 to 9
 |style="background: #cbff7B"|<center>261 pb</center>
-|align="center"|250 pb
+|align="center"|300 pb
 |-
-|align="center"|PCR_125
+|align="center"|PCR_125'
 |align="center"|pFlgB
 |align="center"|1
-|align="center"|3
+|align="center"|10 to 17
 |style="background: #cbff7B"|<center>261 pb</center>
-|align="center"|250 pb
+|align="center"|300 pb
 |-
-|align="center"|PCR_126
+|align="center"|PCR_126'
 |align="center"|pFlhB
-|align="center"|1
+|align="center"|2
-|align="center"|4
+|align="center"|2 to 9
 |style="background: #cbff7B"|<center>260 pb</center>
-|align="center"|250 pb
+|align="center"|300 pb
 |-
-|align="center"|PCR_127
+|align="center"|PCR_127'
 |align="center"|pFlhDC
 |align="center"|2
-|align="center"|2 to 13
+|align="center"|10 to 17
 |style="background: #ff6d73"|<center>446 pb</center>
-|align="center"|nothing
+|align="center"|1,000 pb
 |}
-<br><br><br>
-'''Results'''
-*We have '''no results for pflhDC''', wo don't know yet where is the problem. We will try with other conditions! (yet undetermined)
+==> '''Conclusion:'''
-*Concerning '''pflhB, pflgA and pflgB''', the protocol seems to be '''very operational''': we always have great results !
+*PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the oligos wich are not specific.