Team:Paris/August 8
From 2008.igem.org
(Difference between revisions)
(→creening PCR of transformants) |
(→Minipreps : Plasmid extraction) |
||
Line 23: | Line 23: | ||
|} | |} | ||
<br> | <br> | ||
+ | |||
+ | |||
+ | == '''Amplification of Genes of interest (OmpR, EnvZ, FlhDC)'''== | ||
+ | |||
+ | ''We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.'' | ||
+ | |||
+ | |||
+ | === '''PCR Protocol''' === | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | * '''List of Oligos''' : | ||
+ | {| | ||
+ | |- style="background: #649CD7;" | ||
+ | |- style="background: #649CD7; text-align: center;" | ||
+ | |width=5%| Number | ||
+ | |width=15%| Name | ||
+ | |width=40%| Sequence | ||
+ | |width=5%| Length | ||
+ | |width=30%| Comments | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O126 | ||
+ | | Gene-EnvZ-F | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGGCGATTGCGCTTCTCGCCAC | ||
+ | | 53 | ||
+ | | | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O127 | ||
+ | | Gene-EnvZ-R | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTACCCTTCTTTTGTCGTGCCCTGCGCC | ||
+ | | 59 | ||
+ | | | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O131 | ||
+ | | Gene-FlhC-R | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTAAACAGCCTGTACTCTCTGTTCATCC | ||
+ | | 59 | ||
+ | | | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O132 | ||
+ | | Gene-FlhD-F | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC | ||
+ | | 53 | ||
+ | |Don't amplify the natural rbs of FlhD | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O138 | ||
+ | | Gene-OmpR-F | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCAAGAGAACTACAAGATTCTGG | ||
+ | | 53 | ||
+ | | | ||
+ | |- style="background: #dddddd;" | ||
+ | | style="background: #D4E2EF;" | O139 | ||
+ | | Gene-OmpR-R | ||
+ | | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTATGCTTTAGAGCCGTCCGGTACAAAG | ||
+ | | 59 | ||
+ | | | ||
+ | |} | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | ==== Protocol PCR ==== | ||
+ | ''For each samples,'' | ||
+ | |||
+ | * '''Preparation of the templates''' :<br>--> Resuspend of 1 colony in 100µl of water. | ||
+ | |||
+ | |||
+ | * '''Preparation of PCR mix''' : | ||
+ | 1 µl dNTP | ||
+ | <br>10 µl Buffer Phusion 5x | ||
+ | <br>2,5 µl Oligo_F | ||
+ | <br>2,5 µl Oligo_R | ||
+ | <br>1µl template | ||
+ | <br>1 µl Phusion | ||
+ | <br>50 µl qsp H2O (33µl) | ||
+ | |||
+ | * | ||
+ | {| border="1" | ||
+ | |align="center"|'''Name''' | ||
+ | |align="center"|'''Genes''' | ||
+ | |align="center"|'''Oligo''' | ||
+ | |align="center"|'''Templates''' | ||
+ | |- | ||
+ | |align="center"|PCR_127 | ||
+ | |align="center"|FlhDC | ||
+ | |align="center"|O131_O132 | ||
+ | |align="center"|MG1655 | ||
+ | |- | ||
+ | |align="center"|PCR_128 | ||
+ | |align="center"|OmpR | ||
+ | |align="center"|O138_O139 | ||
+ | |align="center"|strain OmpR* | ||
+ | |- | ||
+ | |align="center"|PCR_129 | ||
+ | |align="center"|EnvZ | ||
+ | |align="center"|O126_O127 | ||
+ | |align="center"|strain EnvZ* | ||
+ | |- | ||
+ | |align="center"|PCR_Control - | ||
+ | |align="center"| - | ||
+ | |align="center"|O126_O127 | ||
+ | |align="center"|Water | ||
+ | |} | ||
+ | <br> | ||
+ | |||
+ | * Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29 | ||
+ | |||
+ | |||
+ | |||
+ | === Electrophoresis Purification of PCR=== | ||
+ | |||
+ | ''When the PCR cycles were finished,'' | ||
+ | |||
+ | '''conditions :''' | ||
+ | |||
+ | * 10µl of ladder 1 kb (unlike 100 pb) | ||
+ | * 2 x 30µl of PCR products added with 10µl of loading Dye 6x | ||
+ | * migration ~30min at 100W on a '''1,5% agarose gel'''. | ||
+ | |||
+ | |||
+ | '''Results of electrophoresis''' | ||
+ | |||
+ | <br>gel 1 [[Image:KR000.jpg| gel 1|150px]] | ||
+ | gel 2 [[Image:KR000.jpg|gel 2|145px]] | ||
+ | |||
+ | {|- border="1" | ||
+ | |align="center"|'''Name''' | ||
+ | |align="center"|'''Promotor''' | ||
+ | |align="center"|'''Gel''' | ||
+ | |align="center"|'''Band''' | ||
+ | |align="center"|'''Expected size''' | ||
+ | |align="center"|'''Measured size''' | ||
+ | |- | ||
+ | |align="center"|PCR_124 | ||
+ | |align="center"|pFlgA | ||
+ | |align="center"|1 | ||
+ | |align="center"|2-3 | ||
+ | |style="background: #cbff7B"|<center>261 pb</center> | ||
+ | |align="center"|300 pb | ||
+ | |- | ||
+ | |align="center"|PCR_125 | ||
+ | |align="center"|pFlgB | ||
+ | |align="center"|1 | ||
+ | |align="center"|4-5 | ||
+ | |style="background: #cbff7B"|<center>261 pb</center> | ||
+ | |align="center"|300 pb | ||
+ | |- | ||
+ | |align="center"|PCR_126 | ||
+ | |align="center"|pFlhB | ||
+ | |align="center"|2 | ||
+ | |align="center"|5-6 | ||
+ | |style="background: #cbff7B"|<center>260 pb</center> | ||
+ | |align="center"|300 pb | ||
+ | |- | ||
+ | |align="center"|PCR_127 | ||
+ | |align="center"|pFlhDC | ||
+ | |align="center"|1 & 2 | ||
+ | |align="center"|7 & 2 | ||
+ | |style="background: #ff6d73"|<center>446 pb</center> | ||
+ | |align="center"|1,000 pb | ||
+ | |} | ||
+ | |||
+ | |||
+ | ==> '''Conclusion:''' | ||
+ | |||
+ | |||
+ | * After electrophoresis, the bands corresponding to the right amplification were excised and purified using the Promega protocol. | ||
+ | * Elution in 30 µL of buffer EB. | ||
+ | * Store at -20°C | ||
==Transformation results== | ==Transformation results== |
Revision as of 09:52, 11 August 2008
Minipreps : Plasmid extractionExtraction of pSB3K3 et E0240 in pSB1A2 plasmid from overnight bacteria culture using the QIAspin Miniprep Kit (QIAGEN) by QIACube.
Amplification of Genes of interest (OmpR, EnvZ, FlhDC)We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.
PCR Protocol
Protocol PCRFor each samples,
1 µl dNTP
Electrophoresis Purification of PCRWhen the PCR cycles were finished, conditions :
Transformation results
PCR Screening of Ligation TransformantsUse of 8 clones of Ligation transformants for screening PCR | Border="1" | Ligation | Name | n° clone | fluorescence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
L128 | pFlgA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OligoF_VF2 (O18) | 1µl | 10µM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OligoR_VR (O19) | 1µl | 10µM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
water | 23µl |
Protocol of screening PCR
- Mix
Name | Vol (µl) | Concentration |
Quick Load | 25µl | 2X |
OligoF_VF2 (O18) | 1µl | 10µM |
OligoR_VR (O19) | 1µl | 10µM |
water | 23µl |
- 50µl of Mix PCR by tube/clone
- one toothpick of each clone's colony by tube
- Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29
Conditions of electrophoresis
- 10µl of ladder 100 pb
- 10µl of screening PCR
- migration ~30min at 100W on 1,5% gel
Results for L100
L100= D110 + D130 = RBS-tetR-ECFP-Ter
Preparation of the newly ammplified promoters
Electrophoresis of the PCR products made yesterday
Electrophoresis settings
- Gel : 1.5 % agar
- 3µL template DNA
- 10µL QuickLoad DNA ladder 100 bp
Name | Promotor | Gel | Band | Expected size | Measured size |
PCR_124 | pFlgA | 1 | 2 | 250 pb | |
PCR_125 | pFlgB | 1 | 3 | 250 pb | |
PCR_126 | pFlhB | 1 | 4 | 250 pb | |
PCR_127 | pFlhDC | 2 | 2 to 13 | nothing |
Results
- We have no results for pflhDC, wo don't know yet where is the problem. We will try with other conditions! (yet undetermined)
- Concerning pflhB, pflgA and pflgB, the protocol seems to be very operational: we always have great results !