Team:Paris/August 8

From 2008.igem.org

(Difference between revisions)
(PCR Protocol)
(PCR Protocol)
Line 126: Line 126:
* Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29
* Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29
 +
 +
 +
=== PCR verification/Analyse ===
 +
 +
''After the PCR :''
 +
* 3µl have been analysed by electrophoresis
 +
* the other 47µl of PCR products have been purified by the Promega kit.
 +
 +
 +
'''Electrophoresis'''
 +
 +
* ladder : 10µl ladder 1 kb
 +
* samples : 3µl of PCR products + 2µl of Loading Dye
 +
* Conditions : migration 30min at 100W, on a '''1%''' agarose gel
 +
 +
* Results :
 +
 +
{| border="1"
 +
|- style="text-align: center;"
 +
|'''Name'''
 +
|'''Promotor'''
 +
|align="center"|'''Gel'''
 +
|align="center"|'''Band'''
 +
|align="center"|'''Expected size'''
 +
|align="center"|'''Measured size'''
 +
|-
 +
|- style="text-align: center;"
 +
|align="center"|PCR_127
 +
|align="center"|FlhDC gene
 +
|align="center"|
 +
|align="center"|
 +
|style="background: #cbff7B"|<center> pb</center>
 +
|align="center"| pb
 +
|-
 +
|- style="text-align: center;"
 +
|align="center"|PCR_128
 +
|align="center"|OmpR gene
 +
|align="center"|
 +
|align="center"|
 +
|style="background: #cbff7B"|<center> pb</center>
 +
|align="center"| pb
 +
|-
 +
|- style="text-align: center;"
 +
|align="center"|PCR_129
 +
|align="center"|EnvZ gene
 +
|align="center"|
 +
|align="center"|
 +
|style="background: #cbff7B"|<center>pb</center>
 +
|align="center"|pb
 +
|}
==Transformation results==
==Transformation results==

Revision as of 12:03, 11 August 2008

← Yesterday

↓ Calendar ↑

Tomorrow →



Contents

Minipreps : Plasmid extraction

Extraction of pSB3K3 et E0240 in pSB1A2 plasmid from overnight bacteria culture using the QIAspin Miniprep Kit (QIAGEN) by QIACube.

  • Carried out 2 times (2 tubes)
name Biobrick plasmid
MP142 - pSB3K3
MP143 E0240 pSB1A2



Amplification of Genes of interest (OmpR, EnvZ, FlhDC)

We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.


PCR Protocol

  • List of Oligos :
Number Name Sequence Length Comments
O126 Gene-EnvZ-F GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGGCGATTGCGCTTCTCGCCAC 53
O127 Gene-EnvZ-R GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTACCCTTCTTTTGTCGTGCCCTGCGCC 59
O131 Gene-FlhC-R GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTAAACAGCCTGTACTCTCTGTTCATCC 59
O132 Gene-FlhD-F GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC 53 Don't amplify the natural rbs of FlhD
O138 Gene-OmpR-F GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCAAGAGAACTACAAGATTCTGG 53
O139 Gene-OmpR-R GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTATGCTTTAGAGCCGTCCGGTACAAAG 59


  • Preparation of the templates :
    --> Resuspend of 1 colony in 100µl of water.
  • Preparation of PCR mix :

For each samples,

1 µl dNTP
10 µl Buffer Phusion 5x
2,5 µl Oligo_F
2,5 µl Oligo_R
1µl template
1 µl Phusion
50 µl qsp H2O (33µl)

Name genes Oligo templates
PCR_127 FlhDC O131_O132 MG1655
PCR_128 OmpR O138_O139 Strain OmpR*
PCR_129 EnvZ O126_O127 Strain EnvZ*
PCR_Control - - O126_O127 Water


  • Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29


PCR verification/Analyse

After the PCR :

  • 3µl have been analysed by electrophoresis
  • the other 47µl of PCR products have been purified by the Promega kit.


Electrophoresis

  • ladder : 10µl ladder 1 kb
  • samples : 3µl of PCR products + 2µl of Loading Dye
  • Conditions : migration 30min at 100W, on a 1% agarose gel
  • Results :
Name Promotor Gel Band Expected size Measured size
PCR_127 FlhDC gene
pb
pb
PCR_128 OmpR gene
pb
pb
PCR_129 EnvZ gene
pb
pb

Transformation results

Name Description Antibio Number of colonies Number of red fluorescent colonies
Ligation
L128 J61002-pFlgA
D136 (FV) - D132 (FI)
Amp ~ 400 2
L129 J61002-pFlgB
D136 (FV) - D133 (FI)
Amp 39 5
L130 J61002-pFlhB
D136 (FV) - D134 (FI)
Amp ~ 1000 4 (but 3 are on the edge of the petri dishe)
L131 J61002-pFlhDC
D136 (FV) - D135 (FI)
Amp 39 38
Control
Control 1 D136 Amp 0 0
Positive control pUC19 Amp 36 0

PCR Screening of Ligation Transformants

Use of 8 clones of Ligation transformants for screening PCR


Ligation Name n° clone fluorescence
L128 pFlgA 1 red
2 red
3 no
4 no
5 no
6 no
7 no
8 no
L129 pFlgB 1 red
2 red
3 red
4 red
5 red
6 no
7 no
8 no
L130 pFlhB 1 red
2 no
3 no
4 no
5 no
6 no
7 no
8 no
L131 pFlgB 1 red
2 red
3 red
4 red
5 red
6 red
7 red
8 no


Protocol of screening PCR

  • Mix
Name Vol (µl) Concentration
Quick Load 25µl 2X
OligoF_VF2 (O18) 1µl 10µM
OligoR_VR (O19) 1µl 10µM
water 23µl


  • 50µl of Mix PCR by tube/clone
  • one toothpick of each clone's colony by tube
  • Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29


Conditions of electrophoresis

  • 10µl of ladder 100 pb
  • 10µl of screening PCR
  • migration ~30min at 100W on 1,5% gel


  • Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29


Electrophoresis Purification of PCR

When the PCR cycles were finished,

conditions :

  • 10µl of ladder 1 kb (unlike 100 pb)
  • 2 x 30µl of PCR products added with 10µl of loading Dye 6x
  • migration ~30min at 100W on a 1,5% agarose gel.


Results of electrophoresis


gel 1 gel 1 gel 2 gel 2

Name Promotor Gel Band Expected size Measured size
PCR_124' pFlgA 1 2 to 9
261 pb
300 pb
PCR_125' pFlgB 1 10 to 17
261 pb
300 pb
PCR_126' pFlhB 2 2 to 9
260 pb
300 pb
PCR_127' pFlhDC 2 10 to 17
446 pb
1,000 pb


==> Conclusion:

  • PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the oligos wich are not specific.

Transformation results

Name Description Antibio Number of colonies Number of red fluorescent colonies
Ligation
L128 J61002-pFlgA
D136 (FV) - D132 (FI)
Amp ~ 400 2
L129 J61002-pFlgB
D136 (FV) - D133 (FI)
Amp 39 5
L130 J61002-pFlhB
D136 (FV) - D134 (FI)
Amp ~ 1000 4 (but 3 are on the edge of the petri dishe)
L131 J61002-pFlhDC
D136 (FV) - D135 (FI)
Amp 39 38
Control
Control 1 D136 Amp 0 0
Positive control pUC19 Amp 36 0

PCR Screening of Ligation Transformants

Use of 8 clones of Ligation transformants for screening PCR


Ligation Name n° clone fluorescence
L128 pFlgA 1 red
2 red
3 no
4 no
5 no
6 no
7 no
8 no
L129 pFlgB 1 red
2 red
3 red
4 red
5 red
6 no
7 no
8 no
L130 pFlhB 1 red
2 no
3 no
4 no
5 no
6 no
7 no
8 no
L131 pFlgB 1 red
2 red
3 red
4 red
5 red
6 red
7 red
8 no


Protocol of screening PCR

  • Mix
Name Vol (µl) Concentration
Quick Load 25µl 2X
OligoF_VF2 (O18) 1µl 10µM
OligoR_VR (O19) 1µl 10µM
water 23µl


  • 50µl of Mix PCR by tube/clone
  • one toothpick of each clone's colony by tube
  • Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29


Conditions of electrophoresis

  • 10µl of ladder 100 pb
  • 10µl of screening PCR
  • migration ~30min at 100W on 1,5% gel


  • Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29


Electrophoresis Purification of PCR

When the PCR cycles were finished,

conditions :

  • 10µl of ladder 1 kb (unlike 100 pb)
  • 2 x 30µl of PCR products added with 10µl of loading Dye 6x
  • migration ~30min at 100W on a 1,5% agarose gel.


Results of electrophoresis


gel 1 gel 1 gel 2 gel 2

Name Promotor Gel Band Expected size Measured size
PCR_124' pFlgA 1 2 to 9
261 pb
300 pb
PCR_125' pFlgB 1 10 to 17
261 pb
300 pb
PCR_126' pFlhB 2 2 to 9
260 pb
300 pb
PCR_127' pFlhDC 2 10 to 17
446 pb
1,000 pb


==> Conclusion:

  • PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the oligos wich are not specific.