Team:Paris/August 8

From 2008.igem.org

(Difference between revisions)

Revision as of 13:54, 11 August 2008

1 Minipreps : Plasmid extraction
2 Amplification of Genes of interest (OmpR, EnvZ, FlhDC)
- 2.1 PCR amplification
  - 2.1.1 Protocol
  - 2.1.2 PCR verification/Analyse
- 2.2 Digestion of PCR products
  - 2.2.1 Protocol :
  - 2.2.2 Purification/Analysis
3 Transformation results
4 PCR Screening of Ligation Transformants

Minipreps : Plasmid extraction

Extraction of pSB3K3 et E0240 in pSB1A2 plasmid from overnight bacteria culture using the QIAspin Miniprep Kit (QIAGEN) by QIACube.

Carried out 2 times (2 tubes)

name	Biobrick	plasmid
MP142	-	pSB3K3
MP143	E0240	pSB1A2

Amplification of Genes of interest (OmpR, EnvZ, FlhDC)

We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.

PCR amplification

Protocol

List of Oligos :

Number	Name	Sequence	Length	Comments
O126	Gene-EnvZ-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGGCGATTGCGCTTCTCGCCAC	53
O127	Gene-EnvZ-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTACCCTTCTTTTGTCGTGCCCTGCGCC	59
O131	Gene-FlhC-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTAAACAGCCTGTACTCTCTGTTCATCC	59
O132	Gene-FlhD-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC	53	Don't amplify the natural rbs of FlhD
O138	Gene-OmpR-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCAAGAGAACTACAAGATTCTGG	53
O139	Gene-OmpR-R	GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTATGCTTTAGAGCCGTCCGGTACAAAG	59

Preparation of the templates :
Resuspend of 1 colony in 100µl of water.

Preparation of PCR mix :

For each samples,

1 µl dNTP
10 µl Buffer Phusion 5x
2,5 µl Oligo_F
2,5 µl Oligo_R
1µl template
1 µl Phusion
50 µl qsp H2O (33µl)

Name	genes	Oligo	templates
PCR_127	FlhDC	O131_O132	MG1655
PCR_128	OmpR	O138_O139	Strain OmpR*
PCR_129	EnvZ	O126_O127	Strain EnvZ*
PCR_Control -	-	O126_O127	Water

Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29

PCR verification/Analyse

After the PCR :

3µl have been analysed by electrophoresis
the other 47µl of PCR products have been purified by the Promega kit.

Electrophoresis

ladder : 10µl ladder 1 kb
samples : 3µl of PCR products + 2µl of Loading Dye
Conditions : migration 30min at 100W, on a 1% agarose gel

Results :

Name	Promotor	Gel	Band	Expected size	Measured size
PCR_127	FlhDC gene			pb	pb
PCR_128	OmpR gene			pb	pb
PCR_129	EnvZ gene			pb	pb

Quantification of the PCR products purified

Blank : 2µl of buffer EB + 98µl of water
Samples : 2µl of PCR purified + 98µl of water.

Results :

Name	Genes	C° (µg/ml)	DO 260/280
PCR_127	FlhDC	350	1.68
PCR_128	OmpR	150	1.97
PCR_129	EnvZ	100	1.77
MP 108 cl2 (23 july)	-vector-	150	1.84

Digestion of PCR products

Protocol :

Name	Genes	Water	DNA	Buffer n°2 10X	BSA 100X	EcoRI	PstI
D139	FlhDC	23.7µl	1µl	3.0µl	0.30µl	1µl	1µl
D140	OmpR	22.7µl	2µl	3.0µl	0.30µl	1µl	1µl
D141	EnvZ	21.2µl	3.5µl	3.0µl	0.30µl	1µl	1µl
D142	-vector-	22.7µl	2µl	3.0µl	0.30µl	1µl	1µl

Incubate 2h30 at 37°C

Purification/Analysis

Electrophoresis

ladder : 10µl ladder 1 kb (for 1%) or ladder 100pb ( for 1.5%)
samples : 3µl of insert + 2µl of Loading Dye
Conditions : migration 30min at 100W, on a 1% agarose gel for the vector and 1.5% for the insert.

Results :

Name	Promotor	Gel	Band	Expected size	Measured size
D139	FlhDC gene			pb	pb
D140	OmpR gene			pb	pb
D141	EnvZ gene			pb	pb
D142	-vector-			pb	pb

Transformation results

Name	Description	Antibio	Number of colonies	Number of red fluorescent colonies
Ligation
L128	J61002-pFlgA D136 (FV) - D132 (FI)	Amp	~ 400	2
L129	J61002-pFlgB D136 (FV) - D133 (FI)	Amp	39	5
L130	J61002-pFlhB D136 (FV) - D134 (FI)	Amp	~ 1000	4 (but 3 are on the edge of the petri dishe)
L131	J61002-pFlhDC D136 (FV) - D135 (FI)	Amp	39	38
Control
Control 1	D136	Amp	0	0
Positive control	pUC19	Amp	36	0

PCR Screening of Ligation Transformants

Use of 8 clones of Ligation transformants for screening PCR

Ligation	Name	n° clone	fluorescence
L128	pFlgA	1	red
		2	red
		3	no
		4	no
		5	no
		6	no
		7	no
		8	no
L129	pFlgB	1	red
		2	red
		3	red
		4	red
		5	red
		6	no
		7	no
		8	no
L130	pFlhB	1	red
		2	no
		3	no
		4	no
		5	no
		6	no
		7	no
		8	no
L131	pFlgB	1	red
		2	red
		3	red
		4	red
		5	red
		6	red
		7	red
		8	no

Protocol of screening PCR

Mix

Name	Vol (µl)	Concentration
Quick Load	25µl	2X
OligoF_VF2 (O18)	1µl	10µM
OligoR_VR (O19)	1µl	10µM
water	23µl

50µl of Mix PCR by tube/clone
one toothpick of each clone's colony by tube
Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29

Conditions of electrophoresis

10µl of ladder 100 pb
10µl of screening PCR
migration ~30min at 100W on 1,5% gel

Program PCR "Screening": Annealing 55°C - Time élongation 1'30" - Number cycle : 29

Electrophoresis Purification of PCR

When the PCR cycles were finished,

conditions :

10µl of ladder 1 kb (unlike 100 pb)
2 x 30µl of PCR products added with 10µl of loading Dye 6x
migration ~30min at 100W on a 1,5% agarose gel.

Results of electrophoresis

gel 1 gel 2

Name	Promotor	Gel	Band	Expected size	Measured size
PCR_124'	pFlgA	1	2 to 9	261 pb	300 pb
PCR_125'	pFlgB	1	10 to 17	261 pb	300 pb
PCR_126'	pFlhB	2	2 to 9	260 pb	300 pb
PCR_127'	pFlhDC	2	10 to 17	446 pb	1,000 pb

==> Conclusion:

PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the oligos wich are not specific.

@@ Line 130: / Line 130: @@
 * Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29
-=== PCR verification/Analyse ===
+==== '''PCR verification/Analyse''' ====
 ''After the PCR :''
@@ Line 213: / Line 213: @@
 |1.84
 |}
 === Digestion of PCR products ===