|
← Yesterday ↓ Calendar ↑Tomorrow →
Amplification of Promotors of interest (FliA, FliL, FlgA, FlgB, FlhB, FlhDC)
We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.
PCR Protocol
- Preparation of the templates :--> Resuspend of 1 colony of MG1655 in 100µl of water.
| Number
| Name
| Sequence
| Length
| Comments
|
| O100
| FlgA-F
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCATATCTCCTCCGCAGGTATCAAAAT
| 58
|
|
| O101
| FlgA-R
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAACAGTATCGCGATGATCGCCACGCTACGT
| 58
|
|
| O102
| FlgB-F
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACAGTATCGCGATGATCGCCACGCTACG
| 58
|
|
| O103
| FlgB-R
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGCATATCTCCTCCGCAGGTATCAAAATT
| 58
|
|
| O108
| FlhB-F
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACGTCATATCAGGCGGTCTGATAAGG
| 58
|
|
| O109
| FlhB-R
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAGTTTTGTCGTCGCTCTCGTCAGACACGTC
| 58
|
|
| O111
| FlhDC-Total-F
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCATTTTTGCTTGCTAGCGTACGGAAAA
| 58
| Amplify the both OmpR binding site
|
| O113
| FlhDC(nu)-R
| GTTTCTTCCTGCAGCGGCCGCTACTAGTACAGAATAACCAACTTTATTTTTATG
| 54
| Don't amplify the natural rbs of FlhD (only promoter)
|
| O124
| FliL-F
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCAGCGAGAGGCTGTTGGTATTAATGACT
| 58
|
|
| O125
| FliL-R
| GTTTCTTCCTGCAGCGGCCGCTACTAGTACCAGCGATGAAATACTTGCCATGCGATTT
| 58
|
|
For each samples,
1 µl dNTP
10 µl Buffer Phusion 5x
2,5 µl Oligo_F
2,5 µl Oligo_R
1µl template
1 µl Phusion
50 µl qsp H2O (33µl)
- Program PCR: Annealing 55°C - Time élongation 1'30" - Number cycle : 29
Electrophoresis Purification of PCR
When the PCR cycles were finished,
conditions :
- 10µl of ladder 1 kb (unlike 100 pb)
- 2 x 30µl of PCR products added with 10µl of loading Dye 6x
- migration ~30min at 100W on a 1,5% agarose gel.
Results of electrophoresis
gel 1 
gel 2 
| Name
| Promotor
| Gel
| Band
| Expected size
| Measured size
|
| PCR_124
| pFlgA
| 1
| 2-3
|
| 300 pb
|
| PCR_125
| pFlgB
| 1
| 4-5
|
| 300 pb
|
| PCR_126
| pFlhB
| 2
| 5-6
|
| 300 pb
|
| PCR_127
| pFlhDC
| 1 & 2
| 7 & 2
|
| 1.000 pb
|
==> Remark : for PCR the negative control (templates = water) can be check on the gel n°2, on the band 3-4
==> Conclusion: for the promotors FlgA, FlgB, FlhB we observe the size expected.
We need to repeat the experiments for the promotors FlhDC.
- After electrophoresis, the bands corresponding to the right amplification were excised and purified using the QIAquick DNA Gel Extraction Kit by "Maurice (QIAcube)".
- Elution in 50 µL of buffer EB.
|
"
